Labshake search
Citations for Illumina :
651 - 700 of 928 citations for Recombinant Mouse Icam2 Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... cDNA was converted into double stranded cDNA using NEBNext mRNA Second Strand Synthesis Module (E6111L) and sequencing libraries were generated by tagmentation using Nextera XT DNA Library Preparation Kit (Illumina FC-131) with 12 cycles of PCR amplification ...
-
bioRxiv - Biochemistry 2022Quote: The sequencing libraries were built by tagmentation using 50 ng of ds cDNA with Illumina Nextera XT Kit (Illumina, #FC-131-1024) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Paired end sequencing was performed on an Illumina NextSeq 500 with a 150-cycle high output kits (Illumina, Cat# FC-404-2002).
-
bioRxiv - Genomics 2023Quote: ... we adapter-ligated libraries by tagmentation using an adaptation of the Nextera Library Prep kit (Illumina, cat. No. FC-121-1030/1031)[25] ...
-
bioRxiv - Genetics 2023Quote: ... 150 pg of cDNA was used to produce sequencing libraries with the Nextera XT DNA Sample Preparation Kit (Illumina, FC-131-1024). Libraries were then sequenced for 50 single read cycles and 30 million reads per sample on Illumina NovaSeq 6000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA-seq libraries were generated from 100pg of amplified cDNA using the NEXTERA XT DNA Library Preparation kit (Illumina, FC-131-1096), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The NGS library was prepared with the Nextera XT DNA Library prep kit following manufacturer’s instructions with changes (Illumina #FC-131-1096). Initially ...
-
bioRxiv - Immunology 2023Quote: ... 150 picograms of cDNA was used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina catalog#: FC-131-1024). Libraries were quantified with Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific catalog# ...
-
bioRxiv - Genomics 2023Quote: HMW DNA from 1.5 x 106 cells was used to generate Illumina libraries with the Nextera XT DNA Library Preparation kit (Illumina FC-131-1024) and Illumina DNA PCR-Free Library Prep ...
-
bioRxiv - Bioengineering 2024Quote: ... The resulting cell nuclei were subjected to incubation for 30 min with Tagment DNA TDE1 Enzyme and Buffer (Illumina, #FC-121-1030). This step fragmented the chromatin and inserted sequencing adapters ...
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were then pooled and sequenced with a NextSeq 500/550 Mid Output v2 kit (150 cycles) according to the manufacturer’s recommendation (Illumina, FC-404-2001). Pooled samples were run in triplicate for a minimum sequencing depth of 20 million reads per sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4) tagmentation was performed with 2ng input and sequencing library generated using the Nextera XT library prep kit (Illumina, #FC-131-1024). In short ...
-
bioRxiv - Immunology 2023Quote: ... For Infinium Mouse Methylation BeadChip (Illumina) arrays ...
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Developmental Biology 2021Quote: ... ATAC-seq libraries for murine endothelial cells were processed as previously described (Buenrostro et al., 2015) and libraries were generated using the Nextera DNA Sample Preparation Kit (Illumina, FC-121-1030). The quality of purified DNA libraries was checked by Agilent High Sensitivity DNA kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... Jude Children’s Research Hospital Hartwell Center with DNA libraries prepared using Nextera XT DNA-Seq library prep kits (Illumina, cat#FC-131-1024) with 96 dual-index bar codes and sequenced on an Illumina MiSeq personal genome sequencer ...
-
bioRxiv - Developmental Biology 2020Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using a custom primer and the High Output v2 kit (75 cycles) (Illumina, #FC-404-2005). The library loading concentration was 2.2 pM and sequencing configuration as following ...
-
bioRxiv - Developmental Biology 2021Quote: Approximately 50,000 nephron progenitor cells were used to generate each sequencing library for the assay for transposase-accessible chromatin (ATAC-seq) using the Nextera DNA Flex Library Prep Kit (Illumina FC-121-1030) with modifications according to a previously published method (Buenrostro et al. ...
-
bioRxiv - Genomics 2022Quote: ... One ng of the pooled amplicons was used for library construction with the Nextera XT DNA library preparation kit (#FC-131–1096; Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads were resuspended in 25 μl of 2X TD Buffer and combined with Tn5 enzyme from the Nextera DNA Sample Preparation Kit (Illumina, FC-121-1030) and water to final volume 50 μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The beads were resuspended in 50 μl of the following PCR master mix with indexed primers from the Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011): Phusion HF 2X (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting library was diluted to 10-pM in 600-μL of HT1 hybridization buffer (Illumina Nextera XT kit Cat#FC-131-1024) and 10-μL was loaded onto a 300-cycle MiSeq Nano v2 flow cell (Illumina Cat#MS-102-2002 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA from approximately 15-20 progeny per mutant were pooled and sequencing libraries were prepared with a Nextera kit (Illumina, FC-121-1030). All whole genome sequencing data is available on NCBI SRA (accession #PRJNA526508) ...
-
bioRxiv - Genomics 2020Quote: ... The dissolved DNA was then tagmented using 0.6 μl TD Tagmentation buffer and 0.3 μl ATM Tagmentation enzyme from Nextera DNA Library Prep Kit (Illumina, catalog no. FC-121-1030) for 5min at 55 °C ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina Catalogue No. FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Genomics 2019Quote: ... Four libraries were paired-end sequenced (75 nt each) with the NextSeq 500 using the Mid Output v2 kit (150 cycles) (Illumina, #FC-404-2001).
-
bioRxiv - Genomics 2019Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using custom ReadOne primer (IDT) and the High Output v2 kit (75 cycles) (Illumina, #FC-404-2005). The library loading concentration was 2.2 nM ...
-
bioRxiv - Genomics 2019Quote: ... the nuclei pellets were resuspended in transposase Master Mix (1.25 μl 10x TD buffer, 5 μl H2O and 6.5 μl of Tn5: Illumina Nextera Kit; FC-121-1031) and incubated for 30 minutes at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... homokaryotic mutants were crossed to a genetically polymorphic Mauriceville strain and approximately 15-20 antibiotic-resistant progeny were pooled and prepared for whole genome sequencing using the Nextera kit (Illumina, FC-121-1030). Mapping of the critical mutations was performed as previously described (Hunter 2007 ...
-
bioRxiv - Genomics 2020Quote: ... High-quality sequencing libraries were constructed by following the protocol of IlluminaTruSeq™ (cat. no. FC-121-2003) DNA preparation kit (Illumina, CA, USA), then were sequenced on Hiseq2000 platform (Novogene ...
-
bioRxiv - Immunology 2021Quote: ... Cells were washed once with PBS before DNA transposition was performed with the Nextera DNA Library Prep Kit (Illumina, Cat. #FC-121-1031). Per sample ...
-
bioRxiv - Neuroscience 2019Quote: ... One ng of the pooled amplicons was used for library construction with the Nextera XT DNA library preparation kit (#FC-131-1096; Illumina, San Diego, CA), according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2020Quote: ... indexing and amplification of the transposed DNA samples was performed by combining 10 µL of transposed DNA with the following: 5 µL of the Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121-1011), 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... The sequencing amplicon pools were diluted to 0.2 ng/µl and tagmented with Nextera XT library prep kit (Illumina, Cat#FC-131-1024). Nextera libraries were dual-barcoded and sequenced on an Illumina NextSeq1000 instrument ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were resuspended in the Nextera transposition reaction mix (25 ul 2x TD Buffer, 2.5 uL Nextera Tn5 transposase (Illumina Cat #FC-121-1030), and 22.5 ul nuclease free H2O ...
-
bioRxiv - Microbiology 2021Quote: Total RNA from tissues was converted to cDNA with SuperScript IV and sequencing libraries prepared with the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1024). Sequencing was performed using the Illumina NextSeq platform with 150bp paired-end reads ...
-
bioRxiv - Microbiology 2019Quote: ... Tagged libraries were pooled and sequenced (300 cycles, paired-end sequencing) in the Illumina HiSeq 4000 instrument using a HiSeq 4000 SBS Kit (Illumina, FC-410-1003). Raw reads were preprocessed using the standard Illumina pipeline to segregate multiplexed reads.
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 ng of the amplified cDNA was converted into the sequencing library with the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1024), according to the protocol supplied ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were sequenced using a custom sequencing primer (GCGACCACCGAGATCTACACACTGACTGCAGTCTGAGTCTGACAG) and the NextSeq® 500/550 Mid Output Kit v2 - 150 cycles (FC-404-2001, Illumina, CA, USA) on the Illumina NextSeq® platform.
-
bioRxiv - Neuroscience 2022Quote: ... A sequencing library was produced using 0.75 ng of the amplified cDNA in the Nextera XT Library Preparation Kit (Illumina, cat # FC-131-1024). For astrocyte RNA-seq ...
-
bioRxiv - Microbiology 2021Quote: ... Next the amplicons were checked for their size and purity on a 1.5 % agarose gel and if suitable subjected to the index PCR using the Nextera XT Index Kit v2 Set C/D (Illumina, FC-131-2003). After index PCR the samples were cleaned again with AmPure XP Beads (Beckman Coulter Life Science Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 pg of cDNA from each sample was used as input for library preparation with the Nextera XT DNA Library Prep Kit (Illumina FC-131-1096). Fragmentation and adaptors insertion were performed by tagmentation ...
-
bioRxiv - Cancer Biology 2022Quote: ... Post-ligation cleanup proceeded according to Illumina’s instructions with 110 µL Sample Purification Mix from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina catalog # FC-151-1002). After purification ...
-
bioRxiv - Developmental Biology 2019Quote: ... Tagmentation and library preparation was done using the Nextera XT DNA Library Prep kit and sequenced using the NextSeq 500/550 High Output Kit v2 (75 cycles) 400 million reads (Illumina, #FC-404-2005) on Illumina NextSeq 500 platform ...
-
bioRxiv - Systems Biology 2019Quote: ... Sequencing library DNA preparation was performed using the Tn5 tagmentation-based method with 1/4 volumes of the Nextera XT DNA Library Preparation Kit (Cat# FC-131-1096, −2001, −2002, −2003, and −2004, Illumina, San Diego, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... 1.5 pM of pool (combined with 40% spiked-in) was loaded onto a NextSeq 500 Mid-Output Kit (150 cycles) cartridge (catalog #FC-102-1001; Illumina, San Diego, CA) for high throughput sequencing on a NextSeq 500 instrument (Illumina) ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting full-length enriched cDNA library was processed into the sequencing library using the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). The quality of the libraries was inspected by size and concentration by agarose gel electrophoresis before pooling the libraries ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA libraries with an average size of 1.5-2 kb were tagmented and indexed during a second PCR amplification step with the Illumina Nextera XT DNA preparation kit (Illumina, FC-131-1024). Tagmentation was performed according to the manufacturer’s protocol with an input of 500 pg cDNA and amplicon tagment mix for 5 min at 55 °C ...