Labshake search
Citations for Illumina :
251 - 300 of 890 citations for Recombinant Human Ribulose 5 Phosphate 3 Epimerase His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... whereas the Illumina Human HT-12 v4 beadchip (Illumina, San Diego, CA) is a genome-wide array targeting about 31,000 genes (with on average 2 probes per gene ...
-
bioRxiv - Genomics 2021Quote: ... DNA methylation levels were measured using Infinium Human Methylation 450 arrays (Illumina) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2023Quote: ... TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) was used to prepare RNA-seq libraries according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNase H or the Ribo-Zero method (human, mouse, plants) (Illumina, USA) was used to remove rRNA ...
-
bioRxiv - Genetics 2024Quote: ... or in the Human Imprintome array BeadChip (Illumina, Inc., San Diego, CA), amplified ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was analyzed using Infinium Human Methylation 450K BeadChip system (Illumina), as described [91] ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Immunology 2023Quote: ... Sequencing was performed in 3 sequencing unit of NovaSeq 6000 (Illumina) (100-nt-length reads ...
-
bioRxiv - Immunology 2023Quote: The 3’ adapters were ligated according to the TruSeq kit (Illumina) manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... dual-indexed 3’ DGE libraries were prepared using Nextera XT (Illumina) and sequenced to depth on the NovaseqS4 platform with a paired-end read structure (R1 ...
-
bioRxiv - Genomics 2020Quote: ... The methylation array used an Infinium Human methylationEPIC BeadChip (Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: RPF were depleted of ribosomal RNA with the Ribo-zero Human kit (Illumina) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2019Quote: ... and rRNA-depletion (“Ribo-Zero”; Illumina Ribo-Zero Gold Kit (Human/Mouse/Rat), Cat # MRZG126 ...
-
bioRxiv - Genomics 2020Quote: ... and analysed using the Infinium Human Methylation 450K BeadChips (Illumina, San Diego, CA) according to the manufacturer’s protocol.
-
bioRxiv - Genomics 2019Quote: We downloaded DNA methylation data as beta values (platform Illumina Human Methylation 450) from GDC Data Portal (50 ...
-
bioRxiv - Genomics 2019Quote: ... in data obtained using Human Infinium Bead Arrays (Illumina’s HM450 or EPIC arrays), an established technology to detect DNA methylation 40 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Methylation was measured using the Infinium Human Methylation 450K BeadChip Array from Illumina. The extent of cytosine methylation was represented by a beta value ranging from 0 (fully unmethylated ...
-
bioRxiv - Genetics 2020Quote: ... or the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... ribosomal RNA was removed using the Ribo-Zero Human/Mouse/Rat kit (Illumina). Sequencing libraries were generated according to the TruSeq stranded total RNA (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... SNP genotyping was performed with the HumaHap650Y_V3 or Human 1M-Duo_V3 BeadChips (Illumina) according to manufacturer’s instruction as previously described [48] ...
-
bioRxiv - Genomics 2023Quote: ... Methylation was assessed using the Infinium Human Methylation 450K Bead Chip (Illumina, Inc). A total of 865918 CpGs were present in the dataset ...
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... was performed using the SureCell WTA 3’ library prep kit (Illumina, 20014279) according to manufacturer’s instructions with minor modifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using 300-cycle kit (v.3, Illumina, Inc., San Diego, CA, USA) to obtain 150 bp paired-end reads.
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Neuroscience 2021Quote: ... 3′ gene expression libraries were dual-index sequenced using NextSeq 150bp (Illumina) flow cells by the Duke Center for Genomic and Computational Biology Core Facility.
-
bioRxiv - Cell Biology 2021Quote: ... The final constructed 3’- biased single cell libraries were sequenced by Illumina Nextseq500 machine ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Immunology 2022Quote: ... and mixed with 3 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96–Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using Illumina whole-genome expression array Human HT-12 V4 (Illumina, Saffron Walden, U.K.). Normalization of the quantified signals (background corrected ...
-
bioRxiv - Developmental Biology 2019Quote: The (Illumina, San Diego, CA gene expression arrays (Illumina Human HT-12 Expression BeadChip) and Infinium 450K CpG methylation raw array data analyzed in these studies were published previously and available at Gene Expression Omnibus under accession numbers GSE65211 and GSE65214 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each library was sequenced to 2x human genome coverage on Novaseq sequencer (Illumina, CA).
-
bioRxiv - Cell Biology 2020Quote: ... then rRNA-depleted using Ribo-Zero rRNA Removal kit for human samples (Illumina MRZH11124) before proceeding with library preparation (TruSeq mRNA Stranded Library preparation kit ...
-
bioRxiv - Cell Biology 2022Quote: ... Ribosomal RNA was removed by Illumina Ribo-Zero Gold rRNA Removal Kit Human/Mouse/Rat (Illumina, San Diego, CA, USA) and stranded total RNA-seq libraries were prepared using the Illumina TruSeq RNA Sample Preparation v2 Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... All RNA samples were treated with RiboZero (Human/Mouse/Rat) (Illumina, San Diego, CA) for the depletion of ribosomal RNA ...