Labshake search
Citations for Illumina :
651 - 700 of 1004 citations for Recombinant Human PECAM1 Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: Libraries were sequenced on an Illumina HiSeq X™ using HiSeq X™ Five Reagent Kit v2(Illumina, Cat# FC-502-2021).
-
bioRxiv - Synthetic Biology 2022Quote: ... Indexes were added to the amplified DNA using i5 and i7 primers from the Nextera XT Index Kit (Illumina # FC-131-1002). Indexed samples were loaded into a MiSeq Reagent Kit v3 600-cycle (Illumina # MS-102-3003 ...
-
bioRxiv - Genomics 2020Quote: ... Samples were prepared for sequencing using 1 ug of genomic DNA following the TruSeq PCR free kit protocol (Illumina, FC-121-3001). Resulting libraries were quality checked on an Agilent DNA 1000 bioanalyzer (Agilent Technologies ...
-
bioRxiv - Bioengineering 2020Quote: ... cDNA libraries were single-end sequenced in 76 cycles using a NextSeq 500 Kit v2 (FC-404-2005, Illumina, San-Diego, CA). High-throughput sequencing was performed using NextSeq500 sequencing system (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries were sequenced using a 150 bp paired-end NextSeq High Output V2 reagent kit (Illumina, FC-404-2004, San Diego, CA). Illumina short reads were assembled into contigs in two steps ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2.5 µL Tn5 transposase and 22.5 µL nuclease-free H2O) using reagents from the Nextera DNA library Preparation Kit (Illumina #FC-121-103). Samples were then incubated at 37°C for 30min ...
-
bioRxiv - Genomics 2020Quote: ... 2000 and underwent a 50 cycle single read sequence run with TruSeq SBS Kit v3-HS reagents (Illumina, Cat. FC-401-3002). The raw sequence reads were aligned to the reference genome using STAR (version 2.7.3a) ...
-
bioRxiv - Cancer Biology 2021Quote: ... A total of 140 pg of the amplified cDNA was fragmented using Nextera XT DNA sample preparation kit (Illumina FC-131-1096) and amplified with Nextera XT indexes (Illumina FC-131-1001) ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Cancer Biology 2020Quote: ... Drop-seq denatured libraries were loaded at 1.3pM final concentration and were spiked in with 10% of 1.8pM PhiX Control v3 (Illumina Cat# FC-110-3001). Sequencing specifications were as follows ...
-
bioRxiv - Genomics 2019Quote: ... Tagmentation of cDNA was performed and sequencing libraries were prepared using the Nextera XT DNA sample preparation kit (Illumina, FC-131-1096) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Second, the pellet was resuspended in the transposase reaction mix (25 μl 2× TD buffer, 2.5 μl transposase (Illumina, FC-121-1030) and 22.5 μl nuclease-free water) ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl each of P7 and P5 Nextera XT Index Kit v2 index primers (Illumina Catalogue numbers FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was diluted 1:15 and subsequently tagmented and amplified for 12 cycles using the Nextera XT DNA Library Preparation Kit (Illumina FC-131). Individual libraries were QC’d by Qubit and Agilent Bioanalyzer ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% spike-in of the ϕX174 control library (Illumina #FC-110-3002) and sequenced on an Illumina NextSeq 500 instrument with a High Output v2 reagent kit (Illumina #FC-404-2005) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL each of P7 and P5 of Nextera XT Index Kit v2 index primers (catalogue No. FC-131-2001 to 2004; Illumina, Cambridge, UK) were also added to each well ...
-
bioRxiv - Immunology 2020Quote: ... The cell pellets were resuspended in 50 μl transposition mix (25 μl 2X TD buffer, 2.5 μl transposase (Illumina, FC-121-1030), 16.5 μl PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were diluted to a final concentration of 2.8 pM in HT1 buffer (supplemented with the kit) and loaded on 75-cycle high-output flow cells (Illumina, FC-404-2005) and sequenced on a NextSeq 550 (Illumina) ...
-
bioRxiv - Genetics 2019Quote: ... 300 pg of each sample was enzymatically fragmented and indexed using a Nextera XT DNA Library Preparation Kit (Illumina FC-131-1024), and Index Kit (Illumina FC-131-1001) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cell pellet was resuspended in 50 μl transposition mix (25 μl 2X TD buffer, 2.5 μl transposase (Illumina, FC-121-1030), 16.5 μl PBS ...
-
bioRxiv - Genomics 2019Quote: ... as per the manufacturer’s instructions and sequenced on an Illumina NextSeq500 machine with 13 libraries pooled at 1.8 pM using one High Output Kit v2 (Illumina #FC-404-2005) with 75 cycles single-end.
-
bioRxiv - Microbiology 2022Quote: ... Libraries were sequenced using a 150 bp paired-end NextSeq High Output V2 reagent kit (Illumina, FC-404-2004, San Diego, CA). Finally ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 000 nuclei were subjected to Tn5 transposition reaction using 2.5 μl TDE1 from Nextera DNA Library Prep Kit (Illumina, #FC-121-1030). After adding the transposition reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... The sequencing libraries were prepared using a modified protocol for the Nextera XT DNA library preparation kit (Illumina Inc. FC-131-1024). The genomic DNA was fragmented ...
-
bioRxiv - Genomics 2023Quote: ... Two biological replicates of 7.5 × 104 cells for each condition were then isolated for direct processing with Nextera Tn5 enzyme (Illumina, FC-131-1096). Samples were treated as previously described (77 ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing adaptors were added by tagmentation and amplified for 12 cycles using the Nextera XT DNA Library Preparation Kit (Illumina, # FC-131). Libraries were pooled at a final concentration of 1.35 pM ...
-
bioRxiv - Biochemistry 2023Quote: ... Paired-end sequencing libraries were generated from each dsDNA sample using the Nextera XT DNA Library Preparation Kit (Illumina FC-131-1024) exactly as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were diluted to a concentration of 0.2 ng/µL and sequencing libraries were prepared using the Nextera XT Library Prep protocol (Illumina FC-131-1024). M-RTPCR and library preparation was performed in duplicate for all viral RNA ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was converted into double stranded cDNA using NEBNext mRNA Second Strand Synthesis Module (E6111L) and sequencing libraries were generated by tagmentation using Nextera XT DNA Library Preparation Kit (Illumina FC-131) with 12 cycles of PCR amplification ...
-
bioRxiv - Biochemistry 2022Quote: The sequencing libraries were built by tagmentation using 50 ng of ds cDNA with Illumina Nextera XT Kit (Illumina, #FC-131-1024) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Paired end sequencing was performed on an Illumina NextSeq 500 with a 150-cycle high output kits (Illumina, Cat# FC-404-2002).
-
bioRxiv - Genomics 2023Quote: ... we adapter-ligated libraries by tagmentation using an adaptation of the Nextera Library Prep kit (Illumina, cat. No. FC-121-1030/1031)[25] ...
-
bioRxiv - Genetics 2023Quote: ... 150 pg of cDNA was used to produce sequencing libraries with the Nextera XT DNA Sample Preparation Kit (Illumina, FC-131-1024). Libraries were then sequenced for 50 single read cycles and 30 million reads per sample on Illumina NovaSeq 6000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA-seq libraries were generated from 100pg of amplified cDNA using the NEXTERA XT DNA Library Preparation kit (Illumina, FC-131-1096), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The NGS library was prepared with the Nextera XT DNA Library prep kit following manufacturer’s instructions with changes (Illumina #FC-131-1096). Initially ...
-
bioRxiv - Immunology 2023Quote: ... 150 picograms of cDNA was used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina catalog#: FC-131-1024). Libraries were quantified with Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific catalog# ...
-
bioRxiv - Genomics 2023Quote: HMW DNA from 1.5 x 106 cells was used to generate Illumina libraries with the Nextera XT DNA Library Preparation kit (Illumina FC-131-1024) and Illumina DNA PCR-Free Library Prep ...
-
bioRxiv - Bioengineering 2024Quote: ... The resulting cell nuclei were subjected to incubation for 30 min with Tagment DNA TDE1 Enzyme and Buffer (Illumina, #FC-121-1030). This step fragmented the chromatin and inserted sequencing adapters ...
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were then pooled and sequenced with a NextSeq 500/550 Mid Output v2 kit (150 cycles) according to the manufacturer’s recommendation (Illumina, FC-404-2001). Pooled samples were run in triplicate for a minimum sequencing depth of 20 million reads per sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4) tagmentation was performed with 2ng input and sequencing library generated using the Nextera XT library prep kit (Illumina, #FC-131-1024). In short ...
-
bioRxiv - Cancer Biology 2021Quote: ... these analyses were performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Neuroscience 2020Quote: ... The Illumina Human CytoSNP-12v2.1 BeadChip array and KaryoStudio analysis software (Illumina) were used to assess genome integrity (Supplementary Table 1).
-
bioRxiv - Molecular Biology 2020Quote: ... with ribosomal depletion using Human/Mouse/Rat Ribo-Zero kit (Epicentre/Illumina). All samples were sequenced using a 100 base-pair (bp ...
-
bioRxiv - Genomics 2022Quote: ... we benchmarked 23 different human genotyping arrays including 14 arrays from Illumina and 9 arrays from Affymetrix ...
-
bioRxiv - Genomics 2020Quote: ... Illumina TruSeq Stranded Total RNA Ribo-Zero Human/Mouse/Rat Gold (Illumina) was used to construct ribosomal RNA depleted sequencing libraries ...
-
bioRxiv - Molecular Biology 2019Quote: ... Trimmed reads were mapped to the human genome (hg38 downloaded from Illumina iGenomes on August 8th ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DNA methylation was quantified using Infinium Human Methylation 27 BeadChip (Illumina, CA) at the Northwestern University Core facility.
-
bioRxiv - Genetics 2021Quote: ... whereas the Illumina Human HT-12 v4 beadchip (Illumina, San Diego, CA) is a genome-wide array targeting about 31,000 genes (with on average 2 probes per gene ...
-
bioRxiv - Genomics 2021Quote: ... DNA methylation levels were measured using Infinium Human Methylation 450 arrays (Illumina) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2023Quote: ... TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) was used to prepare RNA-seq libraries according to manufacturer’s protocol ...