Labshake search
Citations for Illumina :
501 - 550 of 1004 citations for Recombinant Human EFNA5 Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 120 μl pooled 20 pM library and 15 μl denatured 20 pM PhiX control library (Illumina, FC-110-3001) after a 2 minute heat treatment at 96 °C followed by a 5 min incubation on ice ...
-
bioRxiv - Genomics 2021Quote: ... Each sample library was uniquely barcoded and quantified by qPCR using a PhiX Control v3 (Illumina, FC-110-3001) standard curve ...
-
bioRxiv - Genomics 2019Quote: ... and sequenced on an Illumina NextSeq 500 instrument with a High Output v2 reagent kit (Illumina #FC-404-2005), reading 86 nt for read 1 and 6 nt for the P7 index read ...
-
bioRxiv - Genetics 2019Quote: ... All sequencing followed the protocol in the Illumina TruSeq PCR-Free Sample Preparation Guide (Illumina cat# FC-121-2001), and used PCR-free library preparation kits purchased from KAPA Biosystems (see https://www.nhlbiwgs.org/topmed-whole-genome-sequencing-project-freeze-5b-phases-1-and-2 for additional details) ...
-
bioRxiv - Physiology 2020Quote: ... which was processed into the sequencing library using the Nextera XT DNA Library Preparation Kit (FC-131-1096, Illumina) with unique barcode sequences for each set ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transposed fragments were amplified and purified as described previously (Buenrostro 2015) with Nextera Index Kit (FC-121-1011, Illumina). qPCR was performed to determine the optimal number of cycles to amplify the library to reduce artifacts associated with saturation PCR of complex libraries ...
-
bioRxiv - Genomics 2021Quote: Sequencing libraries were generated using the sequencing kit: TruSeq SBS Kit v5 – GA (36 Cycle) (FC- 104-5001, Illumina). Samples were then sequenced on an Illumina GA-IIx sequencer using paired-end (PE ...
-
bioRxiv - Genomics 2021Quote: ... and tagmented using the enzyme and buffer provided in the Nextera Library Prep Kit (Illumina, cat. FC-121-1031). Tagmented DNA was then purified using the MinElute PCR purification kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR-free libraries were prepared from 1μg DNA using the TruSeq PCRfree DNA sample preparation kit (cat# FC-121-3001/3002, Illumina) targeting an insert size of 350bp ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.5 µl of Tagment DNA buffer 1.25 µl of Amplicon Tagment Mix (Nextera XT kit, Illumina FC-131-1096) were added ...
-
bioRxiv - Genomics 2022Quote: ... 600 pg cDNA from each sample plate was used in a modified Nextera XT (Illumina, Cat. FC-131-1024) library preparation but using the P5NEXTPT5 primer and the tagmentation time of 5 mins ...
-
bioRxiv - Genetics 2022Quote: ... Normalised DNA libraries were clustered on Illumina cBot then sequenced using Illumina HiSeq X Ten platform using HiSeq X Ten Reagent Kit v2.5 kits (FC-501-2501, Illumina). Paired end sequencing was performed using the 2×150bp chemistry to achieve an average output of approximately >120 Gb of data per library.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted to 0.2 ng/ul in TE and tagmented (Nextera XT DNA Library Preparation Kit (#FC-131-1096, Illumina). Indexing was performed using the Nextera XT Index Kit (#FC-131-1001 ...
-
bioRxiv - Cell Biology 2022Quote: ... 10μl of the tagmented chromatin was mixed with 2.5μl of Nextera PCR primer cocktail and 7.5μl of Nextera PCR master-mix (Illumina FC-121-1030) in low-binding PCR tubes ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were pooled in equimolar concentrations and sequenced using an Illumina NextSeq 500/550 sequencer (Illumina, FC-404-2005). At least 95% of the reads generated presented a Q score of ≥ 30 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were added with 50mL trans-position reaction mix of Nextera DNA library preparation kit (FC-121-1031, Illumina). DNA was amplified by PCR and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Tagmentation and indexed library amplification were done with Nextera® XT DNA Library Preparation Kit (Illumina, FC-131-1096) and Nextera® XT Index Kit (96 indexes ...
-
bioRxiv - Immunology 2024Quote: ... Two arrays were sequenced per sequencing run with an Illumina 75 Cycle NextSeq500/550v2 kit (Illumina FC-404–2005) at a final concentration of 2.4 pM ...
-
bioRxiv - Microbiology 2024Quote: ... This PCR product was prepared for sequencing using the Nextera XT DNA Sample Prep Kit (Illumina, FC-131-1096) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Genomic DNA was simultaneously fragmented and tagged with sequencing adapters in a single step using Nextera transposome (Nextera XT DNA Library Preparation Kit, Illumina, San Diego, CA, USA). Tagmented DNA was then amplified with a 12-cycle PCR ...
-
bioRxiv - Genetics 2021Quote: ... multiplexing library preparation with a uniquely tagged 6-bp sequence index was performed following the standard Illumina library construction protocol (Illumina, San Diego, California, USA). The libraries with average insert size 250-300 bp were sequenced using an Illumina Novaseq sequencer ...
-
bioRxiv - Microbiology 2022Quote: ... Purified PCR products were fragmented and tagged with the indexed adaptors using the Nextera DNA XT Sample Preparation Kit (Illumina, San Diego, CA, USA). The sequence library was quantified by using the Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen) ...
-
bioRxiv - Genetics 2020Quote: ... MS-103-2003) at a concentration of 15 nM with addition of 15% Phix control v3 (Illumina, FC-11-2003). The Illumina Mi-Seq post-run processing uses the barcoded indices to split all sequences by sample and generate FASTQ files ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then indexed using forward (i7) and reverse (i5) index primers from the Nextera Index Kit (Illumina FC-121-1011). Index ligation and fragment amplification were achieved using the method’s PCR amplification thermal cycling program.
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mono-nucleosomal DNAs were subjected to sequencing using a TruSeq DNA library prep kit (FC-121-2001, Illumina). The final libraries were sequenced using an Illumina HiSeq 2500 platform ...
-
bioRxiv - Molecular Biology 2021Quote: ... Tagmentation of 600pg of cDNA is performed according to Nextera DNA sample preparation manufacturer instructions (Illumina, Inc., FC-131-1096) using a Truseq-P5 hybrid constant oligo (IDT ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Developmental Biology 2019Quote: ... quantification and Nextera library construction were done following the published ChIPmentation protocol (Schmidl et al., 2015) using indexed Illumina adapters (FC-121-1011, Illumina). Illumina adaptors were removed from the ChIP and ChIPmentation reads using Cutadapt (1.6 ...
-
bioRxiv - Systems Biology 2020Quote: cDNA was tagmented and amplified using the Nextera XT DNA Library Preparation Kit (FC-131-1096, Illumina, San Diego, CA). The manufacturer’s protocol was followed with the following modified reagent volumes and primers ...
-
bioRxiv - Immunology 2019Quote: ... and by enzymatic fragmentation of 300 pg of cDNA followed by 12 PCR cycles using the Nextera XT DNA Library Preparation Kit (cat# FC-131-1096, Illumina). Sequencing of the 15 mRNAseq libraries multiplexed together was carried out with an Illumina HiSeq2500 on a 2x125 bp paired-end run.
-
bioRxiv - Genomics 2019Quote: ... Each sample library was uniquely barcoded and quantified by PCR using a PhiX Control v3 (Illumina, Cat #FC-110-3001) standard curve ...
-
bioRxiv - Genetics 2020Quote: ... MS-103-2003) at a concentration of 15nM with the addition of 15% Phix Control v3 (Illumina, FC-11-2003) previously described by Shaukat et al ...
-
bioRxiv - Genomics 2020Quote: ... was performed on the instrument using HiSeq Rapid SBS Kit v2 (FC-402-4021) and HiSeq Rapid PE Cluster Kit v2 (PE-402-4002) (Illumina). Image analysis was performed using the HiSeq Control Software version 2.2.58 ...
-
bioRxiv - Genetics 2020Quote: ... The cell pellet was resuspended with 50 μl transposition mix containing 25 μl 2X TD buffer (Illumina FC-121-1030), 3.5 μl Tn5 transposase (Illumina FC-121-1030) ...
-
bioRxiv - Cell Biology 2021Quote: ... was performed by incubating beads with tagmentation buffer (12.5 µl 2 x TD buffer, 11.5 µl nuclease free water, 1µl Tn5 enzyme (Illumina #FC-131-1024)) at 37°C for 10min ...
-
bioRxiv - Genomics 2021Quote: ... The nuclei-enriched pellet was immediately used for transposition reaction using Nextera DNA Library Prep Kit (Illumina, FC-121-1030). The transposition reaction was incubated at 370C for 30 min and followed immediately by purification using QIAGEN MinElute Kit (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: ... NGS libraries were prepared using 150 pg of cDNA input and the Nextera XT DNA Library Preparation Kit (catalog FC-131-1024, Illumina) with 11 cycles of PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 bases for index 1 and 8 bases for index 2) using the NextSeq 500 High Output Kit 75-cycles (#FC-404-1005, Illumina) loaded at 1.8pM and including 1 % PhiX ...
-
bioRxiv - Plant Biology 2020Quote: ... Nuclei pellets were collected as described previously by centrifugation at 1,000 × g and tagmented with Nextera DNA Library Prep Kit (Illumina, catalog number: FC-121-1030, now discontinued; replacement can be found as Illumina Tagment DNA TDE1 Enzyme and Buffer Kits ...
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Genomics 2022Quote: ... A paired-end library was prepared with the TruSeq DNA PCR-Free LT Sample Preparation Kit (Illumina, #FC-121-3001) from 1 µg of the genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... MS-103-2003) at a concentration of 15nM with the addition of 15% Phix Control v3 (Illumina, FC-11-2003) described by Chaudhry et al ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Neuroscience 2021Quote: ... ~600 pg of purified cDNA was used to produce a RNA-seq library using Nextera XT DNA Library Preparation kit (FC-131-1024, Illumina), following the manufacturer instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... tagmentation was carried out on double-stranded cDNA using the Nextera XT Library Sample Preparation kit (Illumina, FC-131-1096). Each well was mixed with 0.8 µl Nextera tagmentation DNA buffer (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... 100ng of full-lentgth cDNAs are used as input to the Nextera DNA Sample Prep kit (ref FC-121-1030, Illumina) which enriches for 3′ends of cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The sequencing library was prepared using the Illumina TruSeq RNA Sample Prep Kit (FC-122-1001; Illumina, San Diego, CA) with 1 ug of total RNA ...
-
bioRxiv - Cancer Biology 2022Quote: Sequencing libraries were constructed from the cDNA using the Illumina Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). The cDNA library was sequenced on the NovaSeq 6000 instrument using 150-bp paired-end reads.
-
bioRxiv - Developmental Biology 2022Quote: ... RNA-seq libraries were sequenced for 75 cycles in single-end mode on NextSeq 500 platform (Illumina, FC-404-2005).
-
bioRxiv - Cell Biology 2019Quote: Purified cDNA (75 ng) was used as input to the Nextera XT DNA library preparation kit (Illumina, FC-131- 1096), following the manufacturers protocol with the modification of using 1:5 of reagent volumes ...