Labshake search
Citations for Illumina :
151 - 200 of 628 citations for Recombinant Human Aldehyde Dehydrogenase 3 Family MemberA1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were sequenced single-end using 50 bp reads on the HiSeq-2500 and Hi-Seq 4000 platforms (Illumina, San Diego, USA).
-
bioRxiv - Genetics 2022Quote: ... Final library concentrations were diluted to 4nM and submitted for sequencing on the Illumina Hi-Seq 2500 (Illumina, San Diego, CA, USA), 125bp SE in the GSL ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cDNA libraries were singe-end sequenced in 76 cycles using a NSQ 500/550 Hi Output KT v2.5 (Cat #20024906 Illumina, San-Diego, CA) in one multiplex run (N=3/exposure group) ...
-
bioRxiv - Cancer Biology 2021Quote: The Illumina Infinium Human Methylation 450k BeadChip (Illumina 450K array) prostate adenocarcinoma dataset was downloaded from the TCGA consortium database ...
-
bioRxiv - Genetics 2019Quote: ... and genotyped on the Infinium Human CoreExome-24 BeadChip (Illumina). Variants missing >5% of total genotypes and variants that deviated from Hardy-Weinberg equilibrium were removed ...
-
bioRxiv - Cancer Biology 2019Quote: ... and TruSeq Stranded Total RNA Human/Mouse/Rat (Illumina, 20020596) with 100 ng of input and 13 PCR cycles ...
-
bioRxiv - Genetics 2019Quote: ... the Ribo-Zero rRNA Removal kit (Human/Mouse/Rat, Illumina) was employed to deplete ribosomal RNA from 20 µg of total human or mouse brain RNA according to the manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The Illumina Infinium® human 450k (Illumina, WG-314-10031) and EPIC methylation (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... IM and YA using the Sentrix Human CNV370 BeadChip (Illumina) and analysed using GenomeStudio software.
-
bioRxiv - Molecular Biology 2022Quote: ... The Ribo-Zero rRNA Removal Kit (Illumina human/mouse/rat) was applied to remove the rRNAs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina Ribo Zero Gold for human/mouse/rat kit (Illumina) was used to remove rRNA during sample preparation per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genomics 2019Quote: ... and purified before being sequenced with 100-bp single-end using the Illumina Hi-Seq 2500 sequencing platform (Illumina, San Diego, CA, U.S.A.).
-
bioRxiv - Cell Biology 2021Quote: ... Eluted libraries were quantified using a Qubit dsDNA HS Assay Kit and sequenced on a NextSeq 500 or Hi-Seq 4000 (Illumina, San Diego, California). A list of the RNA-Seq samples can be found in Supplementary Table 5.
-
bioRxiv - Developmental Biology 2020Quote: ... The samples were pooled at a concentration of 5nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina, Inc. San Diego, CA) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Immunology 2019Quote: ... Non-stranded sequencing libraries were prepared using Illumina TruSeq RNA library kits and sequenced on an Illumina Hi Seq2500 using a SE70 protocol (Illumina, San Diego, CA). Raw sequenced reads were trimmed for adapter and bar-codes sequences and quality assessed using FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) ...
-
bioRxiv - Genetics 2019Quote: ... DNA was submitted to the Huntsman Cancer Institute High Throughput genomic core for sequencing on a Hi-Seq 2500 (Illumina, San Diego, CA) using 50 cycle-single read chemistry ...
-
bioRxiv - Cell Biology 2023Quote: ... were used instead of the primers that came with the SMARTer Stranded Total RNA HI Mammalian kit to allow for sequencing on the NovaSeq (Illumina, San Diego, CA) by the Biopolymers Facility at Harvard Medical School.
-
bioRxiv - Evolutionary Biology 2023Quote: ... multiplexed and sequenced as 150 bp paired-end reads using two lanes on an Illumina Hi-Seq 2000 (Illumina, San Diego, CA, USA) through Novogene (Beijing ...
-
bioRxiv - Genomics 2024Quote: ... Hi-C libraries for scaffolding were generated and sequenced by Arima Genomics (200.48 million PE 150-bp reads; Illumina NovaSeq; Arima Genomics, USA). To aid gene annotation ...
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Immunology 2024Quote: ... 3 biological replicates were sequenced with NextsSeq 550 (Illumina). For data analysis ...
-
bioRxiv - Microbiology 2021Quote: The genomes of imipenem-resistant recombinants of M2 which had acquired blaOXA-23 were sequenced on a Novaseq instrument (Illumina, 2 × 150 bp paired-end ...
-
bioRxiv - Developmental Biology 2020Quote: ... the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) was used.
-
bioRxiv - Cancer Biology 2021Quote: ... RNAseq-based gene expression and methylation array (Illumina human methylation450K array) data were downloaded from the ICGC data Portal (https://dcc.icgc.org/ ...
-
bioRxiv - Molecular Biology 2020Quote: ... Methylation was analysed using the Infinium Human Methylation EPIC array (Illumina) using standard operating procedures at the UCL Genomics facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... Probe locations on the human genome (hg19 version) defined by Illumina was used for the analysis ...
-
bioRxiv - Genomics 2019Quote: ... with Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). The cDNA libraries from human and mouse samples were sequenced on the Illumina HiSeq 2500 and Illumina NextSeq 500 platforms ...
-
bioRxiv - Cancer Biology 2020Quote: Human RNA sequencing data and DNA sequencing data (Illumina HiSeq RNASeqV2) from the Colorectal Adenocarcinoma dataset from The Cancer Genome Atlas (Nature 2012 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (2022) sequenced 2,504 human genomes to 30x coverage (Illumina NovaSeq 6000). They mapped these data to the human genome assembly GRCh38 and called genotypes using GATK HaplotypeCaller ...
-
bioRxiv - Cancer Biology 2023Quote: Human RNA sequencing data and DNA sequencing data (Illumina HiSeq RNASeqV2) from the Colorectal Adenocarcinoma dataset from the TCGA Nature 2012 and TCGA PanCancer Atlas from The Cancer Genome Atlas were downloaded from cBioPortal for Cancer Genomics (https://www.cbioportal.org/).57–59 Data was log2 transformed and analyzed using the DESeq2 package in R (v3.0).60
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Developmental Biology 2024Quote: ... library construction was immediately carried out using a Chromium Single Cell 3’ Reagent Kit (Version 3) and sequenced on an Illumina HiSeq 4000 or an Illumina NextSeq2000 (Illumina, cat no. 20040559) by the Technion Medicine Faculty Azrieli-Technion Genomics Center ...