Labshake search
Citations for Illumina :
251 - 300 of 8866 citations for Rat Epsin 3 EPN3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-sequencing libraries were prepared using TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat (RS-122-2201; Illumina, CA, USA) according to manufacturers’ protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2020Quote: ... TruSeq SBS Kit v3-HS 50 cycles kit (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA sequencing libraries were generated according to the manufacturer’s instructions for the TruSeq totalRNA with RiboZero Human/Mouse/Rat Gold (Illumina, San Diego, CA, United States). Sequencing was then performed on the NovaSeq6000 (Illumina ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nextera XT Index Kit and Miseq Sequencing Kit (MiSeq Reagent Kits v2,300 cylce) were purchased from Illumina.
-
bioRxiv - Genomics 2022Quote: ... Tagmentation Kit (Illumina) following the Illumina reference guide instructions and recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Ligation kit (Illumina). One ug of RNA was processed for each sample ...
-
bioRxiv - Genomics 2022Quote: ... kit (Illumina #20025523) by the University of Michigan Advanced Genomics Core ...
-
bioRxiv - Genetics 2023Quote: ... Ligation kit (Illumina), followed by 100 bp single-end sequencing on an Illumina NovaSeq 6000 SP system.
-
bioRxiv - Cell Biology 2022Quote: ... Ligation Kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... using either the using NextSeq 500/550 High Output v2.5 (150 cycles) Kit or the NovaSeq 6000 S2 Reagent Kit v1.5 (100 cycles) Kit (Illumina). The Illumina raw BCL sequencing files were processed through the CellRanger software (10x Genomics ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 cycles of PCR for incorporation of unique dual indices (NEBNext multiplex oligos for Illumina) to the final libraries ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Both full-length and 3’ RNA- seq libraries were sequenced on a NextSeq 500 instrument (Illumina) with 5-10 x 106 aligned reads per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina) to perform the sequencing.
-
bioRxiv - Cell Biology 2019Quote: ... COX4I2 and 3’ end of ID1 (green fluorescently labelled BAC (RP5-857M17) provided by BlueGnome (Illumina)) and the 20q telomere probe the TelVysion 20q Spectrum Orange (Cat ...
-
bioRxiv - Genomics 2019Quote: ... The sequencing was conducted on the MiSeq reagent v.3 600 cycles (Illumina, San Diego, CA). The four genomes were assembled using ngs_mapper v1.5 ...
-
bioRxiv - Genomics 2021Quote: ... and dual-indexed 3’ digital gene expression (DGE) sequencing libraries were prepared using Nextera XT (Illumina). Libraries were sequenced on a NovaseqS4 or NovaseqS2 with a paired end read structure (R1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired- end single cell 3’ gene expression libraries were sequenced on a Novaseq 6000 System (Illumina) using a NovaSeq S1 flow-cell to a depth of at least 3.5 × 108 reads/timepoint.
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: scRNA-seq library preparation was performed using 10x Genomics Chromium 3’ single cell library protocol (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Developmental Biology 2023Quote: ... 3’ RNA-seq (Bulk MARS-seq91,135) libraries were prepared and sequenced on a Novaseq 6000 (Illumina) at the Weizmann Crown Institute for Genomics ...
-
bioRxiv - Genomics 2020Quote: ... using the TruSeq SBS Kit v3-HS 200 cycles Kit (Illumina). The raw RNA-seq reads (available at GEO GSE137895 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... The kit employed was TruSeq RNA Library Prep Kit v2 (Illumina) over polyadenylated RNA and the manufacturer’s instructions were followed ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... in the pair-end mode using HiSeq Rapid Pair-end Cluster Kit v2 and HiSeq Rapid SBS Kit v2 500 cycle kit (Illumina) reagents ...
-
bioRxiv - Immunology 2020Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3). Sequence analysis and assembly of lineage trees were performed using an in-house custom analysis pipeline as previously described (39 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and HiSeq SBS Kit V4 50 cycle kit (FC-401-4002, Illumina). NovaSeq 6000 paired-end sequencing was performed using 54 cycles for Read 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were submitted for 10x library preparation for 3’ single cell sequencing on a NovaSeq 6000 (Illumina) at the Cancer Research UK Cambridge Institute ...
-
bioRxiv - Genomics 2021Quote: ... and (3) 134 Gb (~100× depth) chromosome conformation capture sequencing (Hi-C) data (sequenced by Illumina platform).
-
bioRxiv - Cancer Biology 2021Quote: ... then multiplexed 3 libraries per lane and sequenced on the Illumina HiSeq4000 sequencer (Illumina, San Diego, CA) using the 75 bp paired end format.
-
bioRxiv - Genomics 2019Quote: ... (Large insertions and deletions are defined to be greater than or equal to 3 nts for Illumina data or greater than or equal to 5 nts for PacBio data ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were pooled at 3 nM and sequenced on a HiSeq X instrument (Illumina, San Diego, CA) to generate 150 bp paired-end reads (Psomagen ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter) and alternating reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Cell Biology 2020Quote: ... v2 Kit (Illumina Inc.). Illumina novaSeq base call (BCL ...
-
bioRxiv - Cell Biology 2019Quote: ... v2 Kit (Illumina Inc.). Approximately 44*106 reads were obtained for each sample ...
-
bioRxiv - Genomics 2019Quote: Three kits from Illumina were tested with different total RNA input ...