Labshake search
Citations for Illumina :
1 - 50 of 323 citations for Proteasome Subunit Beta Type 3 PSMB3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: Standard Argyrosomus regius gonadotropin subunit amino acidic sequences (alpha common, beta-FSH and beta-LH) were deduced from RNAseq (Illumina and Nanopore) analysis of mRNA extracted from meagre pituitaries ...
-
bioRxiv - Cancer Biology 2022Quote: All 450K array methylation level files were downloaded (Data Type: “Methylation beta value”, Platform: “Illumina Human Methylation 450”; n = 507). The average CpG methylation level over DMRs identified in this study and GENCODE transcript promoters was calculated in all TCGA LUAD and matched normal samples ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... beta values from Illumina HumanMethylation27 (HM27 ...
-
bioRxiv - Microbiology 2021Quote: ... (Canada) (Sequencing type: Illumina NovaSeq 6000 S4 PE100 - 25M reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... Illumina array type (Illumina Infinium MethylationEPIC or Methylation450K BeadChip) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... version 2.0.1.[48] Proportions of methylation values (Illumina “Beta” scale) were calculated ...
-
bioRxiv - Genomics 2021Quote: Beta values were generated from raw intensity signals using GenomeStudio software (Illumina) and exported into R 3.6 for data analysis ...
-
bioRxiv - Genomics 2019Quote: We downloaded DNA methylation data as beta values (platform Illumina Human Methylation 450) from GDC Data Portal (50 ...
-
bioRxiv - Genomics 2020Quote: Three types of sequencing reads from Illumina, PacBio ...
-
IRF1 regulates self-renewal and stress-responsiveness to support hematopoietic stem cell maintenancebioRxiv - Cell Biology 2023Quote: ... Sequencing was performed using Nova Seq S4 (run type: PE100, type of library: NexteraXT, 25 million reads per sample; Illumina). Preprocessing and analysis were done using Galaxy Quality and adapter trimming of reads was performed using RNA Galaxy workbench 2.058 ...
-
bioRxiv - Bioengineering 2024Quote: ... To extract all DNA methylation beta values for the 102 nt BCAT1 promoter measured by Illumina EPIC array ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... Beta-values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). All samples were checked for duplicates by pairwise correlation of the genotyping probes on the 450k/EPIC array ...
-
bioRxiv - Cancer Biology 2020Quote: ... Beta-values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). All samples were checked for duplicates by pairwise correlation of the genotyping probes on the 450k/850k array ...
-
bioRxiv - Cancer Biology 2023Quote: ... We used the pan-cancer batch-corrected normalized gene expression and beta values for methylation from Illumina’s HumanMethylation450 BeadChip ...
-
bioRxiv - Cell Biology 2023Quote: ... beta values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). Out of 865,859 probes on the EPIC array ...
-
bioRxiv - Plant Biology 2021Quote: ... biological replicates for each of eleven tissue types from Illumina mRNA-seq libraries were aligned independently using STAR v2.5.3a (Dobin et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Cancer Biology 2021Quote: ... Beta-values were calculated from the back-transformed intensities using an offset of 100 (as recommended by Illumina). Filtering of CpG probes was performed as described in Capper et al ...
-
bioRxiv - Genomics 2019Quote: ... we calculated Beta-normalized methylation levels based on the normalized intensity levels (according to the recommendation by Illumina).
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Microbiology 2021Quote: ... A draft wild type phi47 genome was assembled de novo from Illumina reads obtained from MiGS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Both types of arrays were scanned on a NextSeq 550 system (Illumina). HMW genomic DNA was sequenced to ∼30x coverage on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Molecular Biology 2020Quote: ... An additional QC measure to determine the concordance of average beta values generated for seven duplicate samples was completed using GenomeStudio (Illumina) v1.8 ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genomics 2020Quote: ... The first type consists of Labyrinthula transcripts generated in this study by sequencing (Illumina) and assembling the transcriptome (Haas et al ...
-
bioRxiv - Genetics 2022Quote: DMDSC genotyping was conducted for approximately 5,801 patients with type 2 diabetes by Illumina using the global screening arrays version (GSA v1.0) ...
-
Alzheimer’s patient brain myeloid cells exhibit enhanced aging and unique transcriptional activationbioRxiv - Neuroscience 2019Quote: ... The libraries were multiplexed within cell types and then sequenced on Illumina HiSeq2500 (Illumina) to generate 50M of single end 50bp reads.
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Genomics 2021Quote: ... HLA types were further confirmed with ImmunoArray-24 BeadChip v2.0 (Infinium) or HumanImmuno BeadChip v1.0 (Illumina) and HLA imputation [36] ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Genomics 2019Quote: ... and Kraken 2.0.8-beta (54) were used to identify the best matching species for each 10x Chromium genomic DNA read (from Illumina HiSeq X and HiSeq4000 platforms). Our Kraken database contained 17 Old World monkey genomes and 19 Plasmodium genomes downloaded from NCBI FTP in June 2018 (52) ...
-
bioRxiv - Genomics 2020Quote: ... Libraries for each sample type were prepared using the TruSeq Stranded Total RNA Library Prep Kit (Illumina), multiplexed and 75 bp paired-end sequenced over 4 lanes on an Illumina NextSeq 500 Sequencing System at the sequencing core facility at LANGEBIO ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...