Labshake search
Citations for Illumina :
1 - 50 of 333 citations for Piggybac Transposable Element Derived 3 PGBD3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... BCLs derived from Illumina sequencing of PIPseq samples were demultiplexed and output in FASTQ format using BCL-convert v4.0.3 ...
-
bioRxiv - Microbiology 2024Quote: ... that was derived from Illumina 12bp barcode sequences published by Caporaso et al ...
-
bioRxiv - Cell Biology 2024Quote: ... Indices were derived from Illumina Nextera (indices 501-517 ...
-
bioRxiv - Evolutionary Biology 2024Quote: Barcode frequencies derived from Illumina sequencing (see Stevenson et al. ...
-
bioRxiv - Genomics 2023Quote: ... All datasets were derived from Illumina RNA-seq experiments performed in 21 different human cell lines (293T ...
-
bioRxiv - Molecular Biology 2024Quote: ... purified and ligated to 3′ and 5′ RNA adapters derived from TruSeq Small RNA Library Preparation Kit (Illumina, San Diego, CA, USA). Small RNA libraries were created using TruSeq Small RNA Library Preparation Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... nodorum isolates that were derived from Illumina genome assemblies published previously (51 ...
-
bioRxiv - Immunology 2022Quote: ... A composite VAR2CSA sequence derived from Illumina sequence pileups from the polyclonal maternal isolate PfM1010 was used to generate a vaccine protein from the ID1-ID2a fragment ...
-
bioRxiv - Microbiology 2023Quote: ... and a DNA fragment containing read1 (Illumina sequencing element), P3 (constitutive promoter for sgRNA expression) ...
-
bioRxiv - Microbiology 2021Quote: LeTRS was designed to analyse FastQ files derived from Illumina paired-end or Nanopore sequencing data derived from a SARS-CoV-2 amplicon protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... The custom procedure was created by combining elements of protocols from Illumina’s NEBNext® Ultra™ II FS DNA Library Prep Kit and Friedrich et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... MVs-derived DNA was amplified using the Sureplex DNA amplification system (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The variants were filtered with Merfin using k-mers derived from Illumina short reads ...
-
bioRxiv - Genomics 2024Quote: Differential gene expression analysis was performed using sequencing reads derived from Illumina short-read sequencing ...
-
bioRxiv - Genetics 2021Quote: We converted the published set of 13,037,955 loci (derived from whole-genome short-read Illumina sequencing using Illumina HiSeq 2000 by [33] ...
-
bioRxiv - Genomics 2021Quote: ROI-derived oligos were each uniquely dual-indexed using the i5 x i7 system (Illumina). A 4 μl aliquot of each re-suspended ROI aspirate containing the photocleaved oligos was amplified in a PCR reaction containing 1 μM i5 and i7 primers and 1× NSTG PCR Master Mix ...
-
bioRxiv - Pathology 2023Quote: ROI-derived oligos were each uniquely dual-indexed using the i5 x i7 system (Illumina). A 4 μl aliquot of each re-suspended ROI aspirate containing the photocleaved oligos was amplified in a PCR reaction containing 1 μM i5 and i7 primers and 1× NSTG PCR Master Mix ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... Single cell derived cDNA libraries were sequenced on NovaSeq S4 cell sequencer (Illumina, San Diego, CA). Cellranger (10x Genomics ...
-
bioRxiv - Genomics 2021Quote: ... Minimap2 44 was used to align the MinION read sequences to the gene sequences derived from Illumina sequences obtained in our previous transcriptome analyses 12 to the contigs ...
-
bioRxiv - Molecular Biology 2021Quote: ... ChIP-derived DNA fragments were submitted for further manipulation by standard ChIP-seq library preparation techniques (Illumina) and Advanced Sequencing on an Illumina NextSeq 500 sequence analyzer as 75 bp single-end reads.
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Genetics 2021Quote: ... and iPSC-derived neural progenitor cells (NPC-FGF) was assessed using the Infinium Human Methylation EPIC BeadChip (Illumina), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... Transcript evidence was derived from 25 RNA-seq read sets (BioProject PRJNA450098, Illumina 2500, 150 bp paired-end) using StringTie v1.3.3b (Pertea et al ...
-
bioRxiv - Immunology 2020Quote: ... we obtained publicly available CD8+ T-cell derived genome wide DNA methylation profiles (K450 Illumina DNA methylation arrays) from two previously published adult patient cohort ...
-
bioRxiv - Genomics 2021Quote: ... sex and 20 genetic principal components (derived from multidimensional scaling of genotype data from the Illumina 610-Quadv1 array).
-
bioRxiv - Immunology 2023Quote: ... Genotyping was carried out using DNA derived from each individual donor using the Infinium Global Screening Array (GSA) v2.0 BeadChip (Illumina) and performed by Macrogen (Korea) ...
-
bioRxiv - Microbiology 2020Quote: ... A reference genome from strain QMA0248 was constructed using both long reads derived from a single Smrt Cell using the PacBio RS II system with P4C2 chemistry and short reads from Illumina HiSeq2000 derived from Nextera XT paired-end libraries as reported elsewhere (NCBI accession no ...
-
bioRxiv - Developmental Biology 2020Quote: Pearson correlations were calculated among all genes across a catalog of 38 tissues/cell types derived from all three germ layers (16 Illumina BodyMap 2.0 tissues ...
-
bioRxiv - Neuroscience 2023Quote: ... and were subsequently sequenced at paired-end 150 bp (DNA libraries) and paired-end 100 bp (RNA derived libraries) on a NovaSeq X Plus (Illumina) platform.
-
bioRxiv - Microbiology 2024Quote: ... we matched the taxonomy of the 16S-based profiles (derived from both 16S primer sets) using the species identified by Illumina as the reference ...
-
bioRxiv - Microbiology 2023Quote: ... second BsmBI site (producing cut-edge between the base pairing region and dCas9 handle binding region) and read2 (Illumina sequencing element) was amplified from pPEPZ-sgRNAclone (Addgene# 141090 ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Genetics 2021Quote: ... sequencing libraries were generated from whole blood-derived fragmented DNA using the TruSeq DNA Nano kit (Illumina, Inc., San Diego, USA) and sequence reads were generated using a HiSeq X Ten1 system (Illumina ...
-
bioRxiv - Microbiology 2024Quote: The whole genome sequence of the mink-derived H5N1 clade 2.3.4.4b virus was determined using the Illumina MiSeq sequencing platform (Illumina, San Diego, CA, USA). Briefly ...
-
bioRxiv - Genetics 2021Quote: We next examined the interaction between the average length of elements and correlation cut-offs when sequencing error was 0.1% (Illumina sequencing error rate). We randomly generated truncated elements with average lengths between 300bps and 2750bps (10 - 90% of the full length element ...
-
bioRxiv - Genomics 2024Quote: ... it enables the observation of all variable sequence elements (spacers, iBARs, and the middle tRNA) with 150-cycle sequencing kits (e.g. Illumina MS-102-3001) and positions spacers and iBARs as early as possible within NGS reads ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genetics 2021Quote: We converted the published set of 13,037,955 loci (derived from whole-genome short-read Illumina sequencing using Illumina HiSeq 2000 by [33]) into VCF format ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing of the cDNA library derived from the isolated hippocampal astrocytes was performed using the NextSeq 500 system (Illumina, San Diego, USA). Raw data from single-end sequences were cleaned using Trimmomatic (version 0.39 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... although sequence data for each isolate is derived from pools of individuals (except from PCR-free Illumina sequence data for S. avenae), all individuals sequenced for a given isolate are expected to contain the same two haplotypes and so sequence data can be combined to reconstruct fully phased haplotypes for each isolate.
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Microbiology 2023Quote: ... the following RNA-derived SRA libraries from BioProjects PRJNA730226 and PRJNA730346 (Gao et al., 2021) were used: SRX10900611– SRX10900613 (150-bp Illumina reads from sporozoites), SRX10900614–SRX10900616 (150-bp Illumina reads from unsporulated oocysts) ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...