Labshake search
Citations for Illumina :
451 - 500 of 1581 citations for PEGSSDA 2 x 0.5 mL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... was combined with short-read whole-genome sequencing data for the 169 individuals (2×125 bp or 2×150 bp Illumina paired-end sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were sequenced on the Illumina NextSeq550 (2×75bp) (Plateforme Transcriptome, IRMB, Montpellier, France) or NovaSeq 6000 (2×75bp) (Illumina) at the CNAG ...
-
bioRxiv - Cell Biology 2020Quote: ... and 90 bases for Read 2 (Illumina 20012862). A PhiX control library was spiked in at 0.2 to 1% ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Genomics 2021Quote: ... TruSeq Library Prep (Illumina, RS-122-2001/2), TruSeq Stranded Library Prep (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... using NextSeq500 2×75pb (Illumina NextSeq 500 platform) (Sup ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Genomics 2019Quote: ... read length of 2×150 bp (Illumina, USA). In total 183 samples were processed including a melanoma cohort (n= 168) ...
-
bioRxiv - Developmental Biology 2019Quote: ... by sequencing (2×75bp) on NextSeq 500 (Illumina).
-
Exploring the microbial diversity in oil-contaminated mangrove sediments using 16S rRNA metagenomicsbioRxiv - Microbiology 2019Quote: ... 2 × 300 bp sequencing process (Illumina, MiSeq V3), and data analysis can be found in our previous articles [12 ...
-
bioRxiv - Genetics 2020Quote: ... 2×150 cycles (Illumina, cat. FC-420-1004), or a Nextseq 500 V2 Mid Output kit ...
-
bioRxiv - Immunology 2021Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3 ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Microbiology 2022Quote: ... for 2 × 250 bp paired-end reads (Illumina) for Rm2011 resulting in 4.45 × 106 reads or the MiSeq reagent kit v3 for 2 × 75 bp paired end reads for Rm2011 cya0 resulting in 5.82 × 106 reads ...
-
bioRxiv - Immunology 2022Quote: ... using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... 2×100 bases paired-end (Novaseq 6000, Illumina).
-
bioRxiv - Microbiology 2023Quote: ... Sequencing (Illumina HiSeq, paired-end, 2×125 bp) was performed by Eurofins Genomics (Ebersberg ...
-
bioRxiv - Genomics 2023Quote: ... and Hi-C (Illumina NovaSeq 6000, 2×150bp) for chromosome-level scaffolding (Fig ...
-
bioRxiv - Bioengineering 2024Quote: ... 10bp (Index i5) and 90bp (Read 2) (Illumina).
-
bioRxiv - Genetics 2021Quote: ... Individual sequencing barcodes were added to each sample by amplifying the entire 40 μL elution in a 100 μL Q5 NEBNext reaction with 0.5 μM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex, Supplementary Table 14) for sample demultiplexing post-sequencing ...
-
bioRxiv - Genomics 2024Quote: ... was used for a tagmentation reaction that included 3 µL of 2X TMP buffer and 0.5 µL of Transposome (BLT; CAT # 20015880, Illumina Inc.), incubated in a thermocycler at 53 ℃ for 30 minutes with the lid set at 80 ℃ ...
-
bioRxiv - Genomics 2020Quote: ... prior to cluster generation and paired-end short-read high throughput sequencing (2×150bp or 2×250bp) on an Illumina MiSeq or NextSeq550 equipment (Illumina, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: Libraries were prepared using NexteraXT and paired-end sequenced on the MiSeq (v3, 2×300 cycles) or iSeq 100 (I1, 2×150 cycles) platforms according to manufacturer instructions (Illumina Inc). All sequences were deposited in the SRA under accession number PRJNA561185.
-
bioRxiv - Microbiology 2021Quote: ... samples were sequenced on either the Illumina HiSeq 4000 or NextSeq sequencer with 2 × 151 bp or 2 × 76 bp reads (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were diluted to 1.8nM and 2×300bp paired-end reads were generated on Illumina MiSeq 2 × 300 bp runs (Illumina, San Diego) by Source Bioscience.
-
bioRxiv - Developmental Biology 2024Quote: ... TDE buffer 25 mL (Illumina)) ...
-
bioRxiv - Cell Biology 2020Quote: ... Whole genome sequencing was performed with 1 μg of the digested DNA using a HiSeq X Ten Sequencer (Illumina) at Macrogen (South Korea).
-
bioRxiv - Genomics 2019Quote: ... The libraries were sequenced with paired-end 150-bp reads on Hiseq X-ten or Novaseq 6000 platform (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries from four 10x channels were pooled together and sequenced on one lane of an Illumina HiSeq X (Illumina) by the Genomics Platform of the Broad Institute.
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Genetics 2022Quote: ... sequence reads were mapped to the mouse reference genome GRCm38/mm10 (iGenomes, Illumina; chromosomes 1-19, X, Y, M) using the Rsubread v1.28.1 package in R v3.4.4 ...
-
bioRxiv - Immunology 2020Quote: ... using the NucleoSpin RNA Kit from Macherey&Nagel according to the manufacturer’s instructions and sequenced on a MiSeq paired-end run (75 x 75, v3; Illumina). Samples were aligned to the mm10 transcript reference using TopHat2 ...
-
bioRxiv - Genomics 2020Quote: ... These DNA libraries were clustered on a cBot Cluster Generation System using HiSeq X HD PE Cluster Kit (Illumina) and sequenced on an Illumina HiSeq X Ten platform at Novogene ...
-
bioRxiv - Pathology 2023Quote: ... Barcoded libraries from each experimental sample were combined in equimolar concentrations of 1.5 pM prior to sequencing at 75bp x 1 (single-end) read metric on a NextSeq 550 (Illumina) system.
-
bioRxiv - Bioengineering 2023Quote: The libraries were paired-end sequenced on Illumina HiSeq X Ten sequencer for 150 cycles (Illumina, San Diego, USA) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and 1.25µM indexing primers (Ad1_noMX primer and Ad2.x indexing primer 45 or IDT for Illumina dual index primers (Illumina, Nextera DNA UD Indexes Set A Ref 20025019) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Pelleted nuclei were incubated in transposase reaction mix (1 X TD reaction buffer, 2.5 µl Tn5 transposase (Nextera, Illumina)) for 30 min at 37 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... and nuclei were resuspended in 50 mL of reaction buffer (TDE1 transposase 2.5 mL (Illumina), TDE buffer 25 mL (Illumina)) ...
-
bioRxiv - Genomics 2021Quote: ... Library preparation followed the TruSeq mRNA 2 (Illumina, USA) protocol and libraries were sequenced on an Illumina HiSeq 2500 platform (two lanes of 125 bp paired-end sequencing) ...
-
bioRxiv - Genomics 2021Quote: ... and sequenced with NovaSeq 6000 (2×150 bp) (Illumina). DNA was isolated from paired tumor-normal samples also using the AllPrep DNA/RNA/Protein Mini kit ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and TruSeq RNA Sample Preparation Kit version 2 (Illumina) according to the manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... and sequencing (HiSeq, 2 × 150bp paired end, Illumina®) were performed by GENEWIZ (South Plainfield ...
-
bioRxiv - Genomics 2022Quote: ... following manufacturer’s recommendations and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Genomics 2022Quote: ... refringens positive and negative samples were generated for RNAseq library construction and sequencing using the same protocol as described above and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Developmental Biology 2020Quote: ... 12 million 2×150 bp reads (Illumina Nextseq 500) were sequenced for each library.
-
bioRxiv - Genomics 2020Quote: ... PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina; see Supplementary Table 2) were not processed through hybridization and sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... by 2×150 Paired End (PE) configuration by Illumina HiSeq ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...