Labshake search
Citations for Illumina :
151 - 200 of 1305 citations for PCR Buffers since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... The permeabilized myonuclei were tagmented with tagmentation mixture optimized for use on a myofiber (20 µL Tagment DNA Buffer (TD Buffer) (Illumina, 20034197), 13.3 µL PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Spheroplasts were washed twice with 500 μL spheroplasting buffer then resuspended in 50 μL 1x TD buffer with TDE (Illumina 20034197). Tagmentation was performed for 30 minutes at 37°Con a rotator and DNA was purified using the DNA Clean and Concentrator 5 kit (Zymo Research D4004) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the nuclei resuspended in 47.5μl of Tagmentation buffer (containing 25μl of 2x Tagmentation buffer from Illumina and 22.5μl of water) before adding 2.5μl of Tn5 enzyme (Illumina Nextera kit ...
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Microbiology 2019Quote: ... The remaining contigs were amplified by PCR from the plasmid preparations that followed two iterations of SpyCas9 selection (those used in PCRs for Illumina library construction). PCR primers (table S6 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and PCR amplification (TruSeq Nano Library Preparation Kit, Illumina). Samples generated with PC v2.0 and panel v4 also had unique molecular identifier (UMI ...
-
bioRxiv - Genetics 2020Quote: ... The first PCR used universal primers (without Illumina indexes) to amplify the barcodes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The 100 PCR samples were then sequenced by Illumina sequencing platform ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free), sequencing and quality checks were done by the Biomics sequencing platform of the Institut Pasteur (C2RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR amplification using Illumina sequencing adaptor primers (Illumina). Paired-end sequencing was performed on a Hi-Seq 2500 System (University of Georgia Genomics Core ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free) and sequencing was done on the C2RT Biomics platform of the Institut Pasteur (using short reads ...
-
bioRxiv - Neuroscience 2019Quote: ... the amplification (cDNA and PCR) and sequencing primers (Illumina) and the low-quality bases were removed using Trimmomatic 0.35 software 63 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Clones were screened by PCR and Miseq sequencing (Illumina).
-
bioRxiv - Genetics 2021Quote: ... the TruSeq DNA PCR-Free Library Preparation kit (Illumina) was employed to make a six-strain library ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification followed Earth Microbiome Project recommendations (“16S Illumina Amplicon Protocol ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1 ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were barcoded and sequenced utilizing MiSeq (Illumina) Nano kit v.2 as described in [84].
-
bioRxiv - Cancer Biology 2022Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [56] was used to align the sequenced reads to the sgRNA library ...
-
bioRxiv - Genomics 2023Quote: ... (2022) (TruSeq DNA PCR-free libraries sequenced on Illumina NovaSeq6000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [82] was used to align the sequenced reads to the sgRNA library ...
-
bioRxiv - Genetics 2023Quote: ... using PCR primers ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGAAGCAGCTCGACGC and GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCTGCCGGAAGTGCT (Illumina adapters underlined) and Phire DNA polymerase (Thermofisher Scientific) ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR-free TruSeq DNA (Illumina, San Diego, CA) was used to prepare a library ...
-
bioRxiv - Cell Biology 2023Quote: ... purified transposed DNA was PCR amplified using Nextera (Illumina) i5 common adapter and unique i7 index adapters and NEBNext High Fidelity 2x PCR Master Mix for 5 cycles with the following program ...
-
bioRxiv - Neuroscience 2024Quote: Libraries were prepared using TruSeq DNA PCR-Free (Illumina) and were sequenced with 150-base-pair paired end reads on an Illumina HiSeq 4000 ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse and forward amplicon PCR primers recommended by Illumina were used (16s Amplicon PCR Forward Primer= TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG ...
-
bioRxiv - Microbiology 2024Quote: ... with the TruSeq PCR-free library prep kit (Illumina) and the Sci clone next-generation sequencing (NGS ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were sequenced with a MiSeq (Illumina) using the reagent kit v3 (PE 2x300 ...
-
bioRxiv - Microbiology 2024Quote: ... which was determined by PCR and confirmed by Illumina whole-genome sequencing for this study.
-
bioRxiv - Cancer Biology 2019Quote: ... after which a custom second-strand synthesis buffer (Illumina), dNTPs ...
-
bioRxiv - Genomics 2021Quote: ... containing 25 µL Nextera Tagment DNA Buffer (Illumina # 15027866), 22.5 µL H2O ...
-
bioRxiv - Genomics 2021Quote: ... Isolated nuclei were resuspended in 1X TDE1 buffer (Illumina) and quantified using a Countess II Automated Cell Counter (Thermo).
-
bioRxiv - Cell Biology 2020Quote: ... after which a custom second-strand synthesis buffer (Illumina), dNTPs ...
-
bioRxiv - Developmental Biology 2022Quote: ... after which a custom second-strand synthesis buffer (Illumina), dNTPs ...
-
bioRxiv - Genetics 2022Quote: ... containing 2.5uL transposase in 1x TD buffer (20034198, Illumina) with 0.001% Digitonin and 0.01% Tween 20 ...
-
bioRxiv - Immunology 2021Quote: ... Cells were resuspended in chilled TD1 buffer (Illumina, 15027866) by pipette-mixing to a target concentration of 2,300-10,000 cells per μL ...
-
bioRxiv - Microbiology 2022Quote: ... containing 25 μL Nextera Tagment DNA buffer (Illumina, USA), 22.5 μL H2O and 2.5 μL Nextera Tagment DNA enzyme I (Illumina ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... after which a custom second-strand synthesis buffer (Illumina), dNTPs ...
-
bioRxiv - Immunology 2023Quote: ... and resuspended in TD Buffer with Tn5 transposase (Illumina). Transposition reaction was performed at 37°C for 45 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was conducted using AceQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on an RT-PCR system (Illumina Eco, California, USA). The primers used are listed in Table 1 ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR products were subjected to sequencing library construction using the TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA). The libraries were loaded on a NovaSeq 6000 system (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... The nuclei were the resuspended in the transposition buffer (2x reaction buffer, Illumina Cat #FC-121-1030, Nextera Tn5 Transposase, Illumina Cat #FC-121-1030) and PCR amplified (KAPA HiFi HotStart ReadyMix ...
-
bioRxiv - Genetics 2021Quote: ... DNA was PCR-amplified with TruSeq dual indexing primers (Illumina) to generate Illumina compatible libraries ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by tailed-PCR using Nextera XT Index Primers (Illumina) (S1B Fig) ...
-
bioRxiv - Genomics 2019Quote: ... After a post-capture PCR (four amplification cycles using Illumina PE PCR 1.0 and PE PCR 2.0 primers ...
-
bioRxiv - Microbiology 2019Quote: ... qPCRs were performed in an Eco RT-PCR system (Illumina). Relative quantification of gene expression was determined by the 2−ΔΔCt method [25] applied with software conforming to minimum information for publication of RT-qPCR experiments (MIQE ...
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were then quantified and sequenced using MiSeq (Illumina).
-
Genomic bases of insularity and ecological divergence in barn owls (Tyto alba) of the Canary IslandsbioRxiv - Evolutionary Biology 2022Quote: ... and individually tagged 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...