Labshake search
Citations for Illumina :
351 - 400 of 1838 citations for P N Nonylphenol Diethoxylate Unlabeled 500 Ug Ml In Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... TCR libraries were sequenced on a NextSeq 500 (Illumina) aiming for a minimum of 5,000 reads per cell ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sequenced with NextSeq 500 (Illumina, San Diego, CA) in HiLIFE DNA Genomics and Sequencing core facility ...
-
bioRxiv - Cell Biology 2023Quote: Sequencing was performed using a NextSeq 500 machine (Illumina; up to 77 or 68 cycles – single end ...
-
bioRxiv - Immunology 2022Quote: ... and paired-end sequenced on Nextseq 500 V2 (Illumina), Read 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and sequenced on a NextSeq 500 (Illumina, software 4.0.2) at the Gladstone Institutes.
-
bioRxiv - Immunology 2023Quote: ... using NextSeq 500 High Output reagent kit (Illumina Inc) (1×75 cycles ...
-
bioRxiv - Genomics 2023Quote: ... Products were sequenced using Illumina sequencing (Illumina NextSeq 500). 4C-seq reads were demultiplexed by matching the 5’- ends of the R1 reads to the reading primer sequence (allowing 2 mismatches) ...
-
bioRxiv - Neuroscience 2023Quote: ... and sequenced on the NextSeq 500 high-output (Illumina) with 85 bp single-end reads ...
-
bioRxiv - Bioengineering 2023Quote: ... prior to sequencing on a NextSeq 500 machine (Illumina) using 28 cycles for read 1 ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing was done using a NextSeq 500 instrument (Illumina) in paired-end mode (2×75 cycles) ...
-
bioRxiv - Developmental Biology 2023Quote: ... read 2 - 91 cycles) performed with Nextseq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were sequenced on the NextSeq 500 platform (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were sequenced on an NextSeq 500 (Illumina Inc.) instrument at Health Sciences Sequencing Core at UPMC Children’s Hospital of Pittsburgh ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were sequenced on a NextSeq 500 instrument (Illumina) as 75-bp single-end reads.
-
bioRxiv - Cell Biology 2023Quote: ... Single read sequencing was performed with NextSeq 500 (Illumina) using 75 cycles High Output kit v2 ...
-
Acinar-to-ductal metaplasia in the pancreas requires a glycolytic switch and functional mitochondriabioRxiv - Cancer Biology 2022Quote: ... The library was sequenced on a NextSeq 500 (Illumina) with 67 cycles for the cDNA in read1 and 16 cycles for the barcodes and UMIs in read2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Dex treated and Input samples by Illumina (NextSeq 500) sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were sequenced on the NextSeq 500 v2 (Illumina) instrument using 150 cycles (18 bp barcode + UMI ...
-
bioRxiv - Cancer Biology 2023Quote: ... the TruSight Oncology 500 (TSO) assay developed by Illumina, and the Oncomine assay developed by ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... using Nextseq 500/550 High Output v2.5 Kit (Illumina) to obtain single end 75 nt reads.
-
bioRxiv - Immunology 2023Quote: ... they were sequenced on a NextSeq 500 instrument (Illumina) with a final loading concentration of 1.4 pM.
-
bioRxiv - Plant Biology 2023Quote: ... using Illumina NextSeq 500 V2 (Illumina, San Diego, USA) to perform GBS with the restriction enzyme MslI ...
-
bioRxiv - Microbiology 2023Quote: ... for sequencing by the NextSeq 500 sequencing platform (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... An Illumina NextSeq 500 sequencer (Illumina, San Diego, CA) was used for sequencing using a 300 cycle (2×150bp ...
-
bioRxiv - Developmental Biology 2023Quote: ... libraries were sequenced by an Illumina NextSeq 500 (Illumina) using a 300-cycle NextSeq 500 High Output v2 Kit cartridge (Illumina ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were sequenced on a NextSeq 500 System (Illumina). Development ...
-
bioRxiv - Developmental Biology 2024Quote: ... Multiplexed libraries were sequenced using a NextSeq 500 (Illumina) to generate 75-nt single-end reads ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing was performed using NextSeq-500 or 2000 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... Sequencing was performed on a NextSeq 500 sequencer (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... The library was sequenced on a NextSeq 500 (Illumina) (59 cycles in read1 and 16 cycles in read2) ...
-
bioRxiv - Cancer Biology 2024Quote: ... was selected and sequenced on a NextSeq 500 (Illumina) using the NextSeq 500/550 High Output Kit v2.5 (150 cycles) ...
-
bioRxiv - Genomics 2024Quote: ... using the MiSeq Reagent Kit v2 500-cycles (Illumina). All isolates included in this study are summarised in Supplementary Table 1.
-
bioRxiv - Developmental Biology 2024Quote: ... Paired-end sequencing was performed on NextSeq 500 (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing was performed on a NextSeq 500 device (Illumina) for the first round and a NovaSeq 6000 (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Microbiology 2020Quote: ... 30 μL of the 20 nM library was diluted to 500 uL using Illumina buffer HT1 and loaded onto a 500 cycle MiSeq (version 2) flowcell (Illumina, MS-102-2003). Paired-end run cycle parameters were 260 (Read1 ...
-
bioRxiv - Systems Biology 2019Quote: ... cDNA libraries were sequenced using the NextSeq 500 High Output Kit (300 cycles, paired end 100 bp) on the Illumina NextSeq 500 platform (Illumina, San Diego, CA). Sequenced reads (length = 30–50 ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end sequencing was performed on the Illumina NextSeq 500 platform using NextSeq 500/550 High Output kit (Illumina, San Diego, CA, USA).
-
bioRxiv - Cell Biology 2021Quote: ... Single-indexed and multiplexed samples were run on an Illumina Next Seq 500 sequencer using a NextSeq 500 v2 kit (FC-404-2005; Illumina, Can Diago, CA) for paired-end sequencing.
-
bioRxiv - Cell Biology 2022Quote: ... Libraries were sequenced on an Illumina NextSeq 500/550 system using NextSeq 500/550 High Output Kit v2.5 (75-cycles, Illumina, San Diego, CA, USA).
-
bioRxiv - Genetics 2023Quote: ... Pooled libraries were diluted and processed for either 75-bp single-end or 35-bp paired-end sequencing on an Illumina NextSeq 500 instrument (ID: NB501524) using the NextSeq 500 High Output v2 kit (75 cycles) (Illumina; FC-404-2005) in accordance with the manufacturer’s instructions.
-
bioRxiv - Genetics 2023Quote: ... Pooled libraries were diluted and processed for 35-bp paired-end sequencing on an Illumina NextSeq 500 instrument (ID: NB501524) using the NextSeq 500 High Output v2 kit (75 cycles) (Illumina; FC-404-2005) in accordance with the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Healthy donor samples were sequenced using a NextSeq 500 using the NextSeq 500 High Output Kit v2.5 (75 cycles) (Illumina, San Diego, CA, USA). We loaded the library at a concentration of 2.0 pM with 10% PhiX and obtained a total of 268 M reads ...
-
bioRxiv - Genomics 2019Quote: ... and marker-wise (HWE P value > 1 × 10−6, call rate > 95%, and for the GSA array additionally by Illumina GenomeStudio GenTrain score > 0.6 ...
-
bioRxiv - Microbiology 2024Quote: ... Raw genomic reads obtained by Illumina HiSeq 2500 and NovaSeq 6000 (for D. grisea, E. coxiae, Galdieria sp. ACUF 613, M. erythrocladioides, P. aerugineum, and T. oligopyrenoides) and by Illumina HiSeq 2500 and NovaSeq 6000 plus Oxford Nanopore MinION Mk 1B (for R ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 2017 (n = 11) were prepared into two Illumina TruSeq LT libraries (Illumina, Inc. San Diego, CA), and sequenced on two Illumina NextSeq500 runs.
-
bioRxiv - Cancer Biology 2020Quote: ... The tagmented and multiplexed cDNA libraries were sequenced in Nextseq 500 using Nextseq 500 High Output v.2 kit (75 cycles, Illumina Cat# FC-404-2005) following Macosko et al ...
-
bioRxiv - Neuroscience 2019Quote: ... 96 libraries were pooled and sequenced in 4 runs using NextSeq 500 High75 Output kits on an Illumina NextSeq 500 instrument (Illumina, San Diego, CA, USA). Reads were pre-processed and mapped using BaseSpace SecondaryAnalysis (version 2.4.19.6 ...
-
bioRxiv - Cell Biology 2024Quote: ... 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Flow lanes were loaded at 1.8pM ...
-
bioRxiv - Cell Biology 2024Quote: ... 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Flow lanes were loaded at 1.8pM ...