Labshake search
Citations for Illumina :
351 - 400 of 8827 citations for Mouse VPS10 domain containing receptor SorCS1 SORCS1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... DNA libraries were prepared using the Nextera XT DNA Library Preparation Kit and Nextera Index Kit (Illumina) following the manufacturer’s protocol with minor modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina). Multiplexed libraries were pooled and paired-end 150-bp sequencing was performed on the Illumina HiSeq 4000 platform at Sidra Medicine ...
-
bioRxiv - Microbiology 2019Quote: ... rRNA depletion was performed (rRNA depletion Kit Ribo Zero Magnetic Kit for Gram-positive bacteria; Epicentre [Illumina]) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was amplified using Ovation V2 kit (NuGEN) and sequencing libraries were generated using NexteraXT kit (Illumina). RNA-seq was carried out on an Illumina HiSeq 4000 ...
-
bioRxiv - Microbiology 2020Quote: ... and libraries were constructed using a kit (NEB Ultra DNA library kit for Illumina; catalogue number E7370L), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were made using TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold Kit (Illumina). These libraries were sequenced using Illumina HiSeq platform with 100 bp single read at a depth of 10-20 million reads per sample.
-
bioRxiv - Microbiology 2022Quote: ... and libraries prepared using the NexteraXT kit and sequenced using HiSeq 1 × 150-cycle v3 kit (Illumina). The operational taxonomic unit (OTU ...
-
bioRxiv - Genomics 2022Quote: ... the TruSeq Stranded Total RNA Sample Preparation Kit and ScriptSeq v2 RNA-seq library preparation kit (Illumina) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were generated using TruSeq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75bp paired-end sequencing method (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... for 2 × 250 cycles using MiSeq PE cluster generation kits and MiSeq SBS Kit sequencing reagents (Illumina).
-
bioRxiv - Physiology 2023Quote: ... was purchased from Beckman Coulter. TruSeq PE Cluster Kit v3-cBot-HS kit (cat. PE-401-3001) was purchased from Illumina. Biospin Tissue Genomic DNA extraction Kit (cat ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina) as per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-seq libraries were generated using Truseq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75□bp paired-end sequencing method (Illumina ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the NextSeq 500/550 High Output Kit v2.5 (300 Cycles) kit (cat. no. 20024908) (Illumina Inc.). The quality of the sequencing outputs was controlled using FastQC version 0.11.9 (Simon ...
-
bioRxiv - Microbiology 2023Quote: ... 500-cycle MiSeq Reagent Kit v2 or 600-cycle MiSeq Reagent Kit v3 (Illumina, California, United States), creating 2 × 150 ...
-
bioRxiv - Neuroscience 2022Quote: ... For mouse and rat sequencing data the reference genome GRCm38 and Rnor 6.0 provided by Illumina igenomes were used ...
-
bioRxiv - Genetics 2023Quote: For samples to be run on the Illumina Infinium® Mouse Methylation BeadChip Array (Illumina, 20041558), 7 μL of recovered TrueMethyl template were mixed with 1 μL of 0.4 N NaOH following manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using the HiSeq PE Rapid Cluster Kit v2 and HiSeq Rapid SBS Kit v2 (200 cycles, Illumina, USA) in the 100bp pair-end mode.
-
bioRxiv - Genomics 2021Quote: ... Cluster generation was performed using HiSeq SR Cluster Kit v3 cBot kits (Illumina Inc, San Diego, CA, USA).
-
bioRxiv - Microbiology 2021Quote: DNA libraries were constructed with the Nextera XT Library Preparation Kit and Index Kit (Illumina, San Diego, CA). DNA libraries were pooled and sequenced on both the Illumina HiSeq5000 and HiSeq2500 and fastq files were generated from demultiplexed reads with bcl2fastq Conversion Software (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... and NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) or NovaSeq 6000 S4 Reagent Kit v1.0 (100 cycles) (Illumina) following manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: DNA libraries were constructed with the Nextera XT Library Preparation Kit and Index Kit (Illumina, San Diego, CA). DNA libraries were pooled and sequenced on both the Illumina HiSeq5000 and HiSeq2500 and fastq files were generated from demultiplexed reads with bcl2fastq Conversion Software (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NEBNext Ultra DNA Library Prep Kit for Illumina (formerly NEBNext DNA Library Prep Kit for Illumina; New England Biolabs Inc. ...
-
bioRxiv - Immunology 2021Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3, 600-cycle, Illumina Inc., CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... a combined kit for the ribosomal (rRNA) depletion Ribo-Zero™ Kit (Bacteria) (Epicentre, Illumina, Madison, WI USA) and cDNA library construction kit ...
-
bioRxiv - Genomics 2023Quote: ... using the S2 Reagent Kit v1.5 Paired End 2×50 base (100 cycle) sequencing kit (Illumina cat. #20028316). Sequencing parameters were set for R1 at 28 cycles ...
-
bioRxiv - Genetics 2022Quote: ... rRNA was depleted with EPiCenter Ribo-Zero Magnetic Gold Kit (Yeast) RevA kit (Illumina Inc, San Diego, CA), and the remaining RNA was purified using Agencourt RNACleanXP (Beckman Coulter ...
-
bioRxiv - Genetics 2023Quote: ... using the HiSeq 3000/4000 SBS Kit or NovaSeq 6000 SP or S2 Reagent Kit (100 Cycles) (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... using the HiSeq 3000/4000 SBS Kit or NovaSeq 6000 S2 or S4 Reagent Kit (200 Cycles) (Illumina). An average of 64 million paired reads were generated per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Genetics 2020Quote: ... 0.02 µM of specific adapters for the Illumina technology (containing the barcode sequences and complementary to the Illumina ™ primers for sequencing) were connected to the fragments ends generated in the digestion ...
-
bioRxiv - Plant Biology 2023Quote: ... The nuclei pellet was then immediately resuspended in 25 μ L of 2x tagmentation buffer containing 2 μ L of TDE1 (Illumina). The reaction was placed at 37C for 30 minutes with gentle mixing three times ...
-
bioRxiv - Plant Biology 2020Quote: ... The ARTseq/TruSeq Ribo Profile Kit (Illumina) was used to construct sequencing libraries ...
-
bioRxiv - Developmental Biology 2021Quote: ... TruSeq Stranded mRNA Library Preparation Kit (Illumina) was used to make the libraries for sequencing according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... TruSeq Stranded mRNA library prep kit (Illumina) was used to generate the mRNA libraries ...
-
bioRxiv - Developmental Biology 2021Quote: ... Nextera XT DNA library preparation kit (Illumina) was used to prepare library.120pg of cDNA was simultaneously fragmented and tagged with adapter sequences by transposome ...
-
bioRxiv - Cell Biology 2020Quote: ... for NGS using the V2 kit (Illumina). All raw and processed sequencing data have been submitted to the NCBI Genome Expression Omnibus (GEO ...
-
bioRxiv - Developmental Biology 2021Quote: ... or a TruSeq Stranded mRNA kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Truseq RNA sample preparation kit v2 (Illumina) was used for the preparation of sequencing libraries ...
-
bioRxiv - Immunology 2021Quote: ... or S4 Reagent Kit (300 cycles) (Illumina). An average of 129 million paired reads was generated per sample.
-
bioRxiv - Genetics 2021Quote: ... using TruSeq SBS Kit v3-HS (Illumina). RNAseq data are available on GEO using accession number GSE145852.
-
bioRxiv - Evolutionary Biology 2020Quote: ... with TruSeq PE Cluster Kit v3 (Illumina) and after that sequenced using Illumina HiSeq 2000 sequencing machine ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified using the SmartSeq2 kit (Illumina) for the study within the somatic lineage and SMART-Seq v4 Ultra (Takara Bio ...
-
bioRxiv - Genomics 2020Quote: ... or TruSeq NanoDNALT Library Prep Kit (Illumina) were used to generate dual-indexed sequence following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... using a NovaSeq S4 Reagent Kit (Illumina). Sequencing was performed using the following read protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... a Hiseq 4000 SR Cluster Kit (Illumina) was used using 8 pM of pooled normalized libraries on the cBOT V2 ...
-
bioRxiv - Genomics 2020Quote: ... and HiSeq Rapid SBS Kit v2 (Illumina), HiSeq X (Illumina ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using the Paired-End Clustering kit (Illumina). Each pool DNA library was further paired-end sequenced on a HiSeq 2500 (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... Using the TruSeq nano DNA kit (Illumina), the 3’ ends of blunt fragments were adenylated ...
-
bioRxiv - Systems Biology 2019Quote: ... and TruSeq DNA Sample Prep Kit (Illumina) according to the manufacturer’s recommendations ...