Labshake search
Citations for Illumina :
1 - 50 of 9807 citations for Mouse Tryptophan 2 3 Dioxygenase TDO2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 brain regions per mouse using the TruSeq stranded mRNA LT kit (Cat# RS-122-2101, Illumina). These synthetic RNAs cover a range of concentrations ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Genomics 2020Quote: RNA from a subset of human fetal (n = 3) and mouse (n = 8) cortex tissue samples was prepared with TruSeq Stranded mRNA Sample Prep Kit (Illumina) and subjected to 125bp paired-end sequencing using a HiSeq2500 (Illumina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Microbiology 2020Quote: ... The obtained partitions were further processed using the Chromium Single Cell 3’ Reagent Kit (version 2, 10x Genomics) to generate Nextera XT sequencing libraries that were sequenced on a HiSeq3000 (Illumina), using a single flow cell lane for each library.
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... 2 μg of total RNA were treated with the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat; Illumina). Depleted RNA was precipitated 1h at −80°C in three volumes of ethanol plus 1 μg of glycogen ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 ug of total RNA were processed for rRNA depletion by Ribozero Gold rRNA Removal kit (Human/Mouse/Rat) (Illumina) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... Goe13 and lysogens and sequenced with the MiSeq system and reagent kit V.3 (2 x 300 bp) (Illumina, San Diego, CA, USA) and the NovaSeq system (2x 150bp ...
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... v1.5 small RNA 3’ adaptor kit (Illumina FC-102-1009) or by using TruSeq directional small RNA kit (Illumina RS-200-0012) ...
-
bioRxiv - Plant Biology 2023Quote: ... with the MiSeq reagent kit version 3 (600 cycles; Illumina). The reads were cleaned up using the cutadapt ver ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Immunology 2020Quote: ... using NextSeq 500/550 v2.5 sequencing reagent kit (read length: 2 × 75 bp) or NovaSeq S1 sequencing reagent kit (read length: 2 × 100 bp) (Illumina) respectively ...
-
bioRxiv - Immunology 2020Quote: ... Sequencing was performed in a high-throughput MiSeq machine using either a v2 Nano reagent kit 2×250bp or a v3 reagent kit 2×300bp (Illumina) at the Genomic Research Unit (GRU ...
-
bioRxiv - Immunology 2020Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3). Sequence analysis and assembly of lineage trees were performed using an in-house custom analysis pipeline as previously described (39 ...
-
bioRxiv - Immunology 2023Quote: The 3’ adapters were ligated according to the TruSeq kit (Illumina) manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3 ...
-
bioRxiv - Immunology 2022Quote: ... using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Immunology 2023Quote: ... alpha/beta libraries were prepared on 100 ng of RNA from each sample using the SMARTer Mouse TCR α/β Profiling Kit from Takarabio® and sequenced using the MiSeq V2 2×150bp (Illumina®) and HiSeq2500 V2 2×150bp (Illumina® ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was performed using the SureCell WTA 3’ library prep kit (Illumina, 20014279) according to manufacturer’s instructions with minor modifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using 300-cycle kit (v.3, Illumina, Inc., San Diego, CA, USA) to obtain 150 bp paired-end reads.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and TruSeq RNA Sample Preparation Kit version 2 (Illumina) according to the manufacturers’ protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Genetics 2019Quote: ... the Ribo-Zero rRNA Removal kit (Human/Mouse/Rat, Illumina) was employed to deplete ribosomal RNA from 20 µg of total human or mouse brain RNA according to the manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Ribo-Zero rRNA Removal Kit (Illumina human/mouse/rat) was applied to remove the rRNAs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina Ribo Zero Gold for human/mouse/rat kit (Illumina) was used to remove rRNA during sample preparation per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... stand-alone Ribo-Zero kits [Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat)] (Illumina), Ribo-Zero accompanied by a TruSeq Stranded Total RNA Kit (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared using a 3′-Tag-RNA-Seq library kit (Illumina). Sequencing was performed using one lane of a Hi-Seq 4000 platform with pair-end 40 bp reads ...
-
bioRxiv - Microbiology 2019Quote: ... using the v2 2×250 base-pair kit (Illumina, Inc.). Positive/negative controls were included for DNA extraction and amplification.
-
bioRxiv - Genomics 2023Quote: ... The resulting sequencing libraries were sequenced using the MiSeq system (Illumina v.2 kit, 2 × 150 bp).
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Developmental Biology 2024Quote: ... library construction was immediately carried out using a Chromium Single Cell 3’ Reagent Kit (Version 3) and sequenced on an Illumina HiSeq 4000 or an Illumina NextSeq2000 (Illumina, cat no. 20040559) by the Technion Medicine Faculty Azrieli-Technion Genomics Center ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... Obtained RNA was depleted of rRNAs with Ribo-Zero Gold Kit (Human/Mouse/Rat) kit (Illumina), separated in 17% Urea gel and stained with SYBR Gold (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) was used.