Labshake search
Citations for Illumina :
451 - 500 of 9441 citations for Mouse Fragile X Mental Retardation 1 Neighbor Protein FMR1NB ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The DNA library was paired-end sequenced (2 x 151 bp) on a NovaSeq S4 system (Illumina, USA). A long-read sequencing library was prepared according to the SQK-LSK110 protocol (ONT ...
-
bioRxiv - Microbiology 2023Quote: ... The 16S rRNA gene amplicons were sequenced using the 2 x 300 bp paired-end MiSeq protocol (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then amplified and paired-end sequencing (2 x 41 cycles) was performed on NextSeq 500 (Illumina). See Supplementary Table 2 for sequenced ATAC-seq samples.
-
bioRxiv - Genomics 2024Quote: Pooled libraries were sequenced at 150 bp paired ends using HiSeq X Ten (Illumina, San Diego, CA, U.S.) by Macrogen Japan (Tokyo ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was tagmented in 5 technical replicates of 1 ng cDNA each using the Nextera XT Kit (Illumina), according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... DNA libraries were prepared from 1 ng of genomic DNA using Nextera XT DNA Library Prep kits (Illumina) for low fluorescence bulks and for high fluorescence bulks (control populations were not sequenced) ...
-
bioRxiv - Genomics 2020Quote: ... sequencing libraries were prepared from 1 ng gDNA using the Nextera XT Library Preparation Kit v.3 (Illumina) and sequenced on the Illumina NextSeq system (paired end 2 x 150 bp insert size) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... from 1 μg DNA using the TruSeq PCRfree DNA sample preparation kit (FC-121-3001/3002, Illumina Inc.) targeting an insert size of 350 bp as directed ...
-
bioRxiv - Genetics 2021Quote: ... 1 µg of high quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was tagmented in 10 technical replicates of 1 ng cDNA each using the Nextera XT Kit (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were generated from 1 ng genomic DNA by using the Nextera XT DNA Library Prep Kit (Illumina). Sequencing was performed using a MiSeq Reagent Kit v3 cartridge (600-cycle kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA-seq libraries were prepared from > 1 μg of total RNA using TruSeq RNA sample prep kit (Illumina) according to the manufacturers’ instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... and homozygous sftb-1(cer6) larvae) were prepared using the TruSeq™ Stranded Total RNA kit protocol (Illumina). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was used to prepare libraries using the TruSeq Stranded mRNA-Seq kit (Illumina). Reads were aligned to TAIR10 using Tophat69 by allowing up to two mismatches and mapping only to one location ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were prepared from 1 ng of DNA using the Nextera XT DNA Library Prep kit (Illumina) and libraries concentrations were normalised using bead normalisation as described by the manufacturer ...
-
bioRxiv - Genomics 2019Quote: ... 10% v/v dimethylformamide) containing 1 μl Tagment DNA Enzyme from the Nextera DNA Sample Prep Kit (Illumina) and incubated at 37°C for 10 min followed by 2x washing in RIPA-LS and TE (10mM Tris-HCL ...
-
bioRxiv - Microbiology 2021Quote: ... then 1 μg of RNA was used for library preparation with TruSeq Stranded mRNA Library Preparation Kit (Illumina) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... each 1 μL of 10 μM forward and reverse primers from Nextera XT Index Kit v2 (Illumina, USA), 8 μL of nuclease-free water ...
-
bioRxiv - Systems Biology 2022Quote: ... 1 ng of cDNA was “tagmented” and bar coded using a Nextera XT DNA Sample Preparation Kit (Illumina). The final libraries were purified using AmPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg of DNA was used to generate sequencing library using the mRNA-Seq Sample Preparation Kit (Illumina) and sequenced on an Illumina Hiseq platform (Novagene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We generated Illumina cDNA libraries from 1 μg of purified RNA using KAPA Stranded mRNA-Seq Kit (Illumina), and uniquely indexed libraries using unique dual indexes (Illumina) ...
-
bioRxiv - Plant Biology 2024Quote: ... prior to generating individual indexed libraries each from 1 μg RNA using the Stranded mRNA Prep kit (Illumina), as recommended ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng of amplified RNA was used to prepare cDNA libraries (Nextera XT DNA library preparation kit; Illumina). cDNA libraries for 4 biological replicates for both control (THD’GAL4/+ ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse GRCm38/mm10 genome annotation was accessed from Illumina’s iGenomes repository (available at https://support.illumina.com/sequencing/sequencing_software/igenome.html ...
-
bioRxiv - Genomics 2019Quote: ... The libraries were sequenced with paired-end 150-bp reads on Hiseq X-ten or Novaseq 6000 platform (Illumina).
-
bioRxiv - Microbiology 2020Quote: The DNA library was prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina according to the manufacturer’s instructions and shotgun-sequenced using the Illumina MiSeq platform with a read length of 2 x 150bp (Illumina). In total ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries from four 10x channels were pooled together and sequenced on one lane of an Illumina HiSeq X (Illumina) by the Genomics Platform of the Broad Institute.
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Microbiology 2020Quote: ... One paired end sequencing run (2 x 301) was completed on an Illumina MiSeq instrument (Illumina, San Diego, CA) using v3 chemistry ...
-
bioRxiv - Microbiology 2020Quote: ... The genomic libraries were sequenced as 2 x 150 bp reads on Illumina Novaseq 6000 (Illumina, San Diego, CA) at UC San Francisco Sequencing Core to generate ~2.17 Gb of sequence ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing of a paired-end 2 × 150 bp mode on a HiSeq X system (Illumina, San Diego, CA, USA) was done by BGI Japan (Kobe ...
-
bioRxiv - Immunology 2020Quote: ... using the NucleoSpin RNA Kit from Macherey&Nagel according to the manufacturer’s instructions and sequenced on a MiSeq paired-end run (75 x 75, v3; Illumina). Samples were aligned to the mm10 transcript reference using TopHat2 ...
-
bioRxiv - Microbiology 2021Quote: ... and sequenced on an Illumina HiSeq 2500 using TruSeq 2 x 100 base pair (bp) paired-end chemistry (Illumina) by UAGC.
-
bioRxiv - Microbiology 2021Quote: ... Paired-end Illumina sequencing (2 x 150 bp) was performed for each metagenomic library on Hiseq Xten instruments (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... Paired-end sequencing (2×150 bp) and PCR-free whole genome sequencing was performed on a HiSeq X (Illumina) 54 ...
-
bioRxiv - Bioengineering 2023Quote: The libraries were paired-end sequenced on Illumina HiSeq X Ten sequencer for 150 cycles (Illumina, San Diego, USA) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and 1.25µM indexing primers (Ad1_noMX primer and Ad2.x indexing primer 45 or IDT for Illumina dual index primers (Illumina, Nextera DNA UD Indexes Set A Ref 20025019) ...
-
bioRxiv - Cancer Biology 2023Quote: ... following the manufacturer’s protocols and sequenced using the 2 x 75 bases paired-end protocol on a NextSeq550 instrument (Illumina). For differential expression analysis ...
-
bioRxiv - Microbiology 2024Quote: ... A 2 x 300 bp paired-end sequencing was performed on an Illumina MiSeq platform (Illumina, Inc., Sandiego, CA).
-
bioRxiv - Immunology 2024Quote: ... Sequencing was performed with 2 x 100 bp read length and 50 million clusters/probe on NovaSeq 6000 (Illumina). Normalization data was provided by CeGat ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sequencing libraries were prepared from 1 μg total RNA using the TruSeq Standard mRNA LT Sample Preparation Kit (Illumina) and sequenced by Illumina NextSeq500 (Illumina ...
-
Enterobacter sp. SA187 mediates plant thermotolerance by chromatin modification of heat stress genesbioRxiv - Plant Biology 2020Quote: We performed mRNA libraries with 1 µg of total plant RNA using a stranded mRNA Library Prep kit (Illumina). Pooled libraries were sequenced using Illumina HiSeq 4000 platform which resulted in paired-end reads of length 151 bps ...
-
bioRxiv - Molecular Biology 2019Quote: ... Initial RNA-seq libraries were made using the TruSeq RNA prep kit by Illumina (shW, shSv210-1, shSv210-2). A second set of libraries from shW ...
-
bioRxiv - Genetics 2020Quote: ... were incubated in a 50 µl reaction with 0.8 µl of Tn5 transposase at 1× TD buffer from the Nextera library preparation kit (Illumina) for 5 min at 55°C ...
-
bioRxiv - Genomics 2021Quote: ... Complementary DNA (cDNA) libraries were prepared from 1 μg RNA using TrueSeq RNA Sample Prep Kit (Illumina, California, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were sequenced according to the Illumina user manual with 80 cycles of read 1 (forward) using the NextSeq 500/550 High Output Kit v2.5 (75 Cycles) (Illumina) with the 20% PhiX spike in Illumina PhiX control kit (Illumina).
-
bioRxiv - Pathology 2019Quote: ... NGS libraries were prepared from 1 ng of extracted DNA using Nextera®XT DNA Sample Preparation Kit (Illumina), and sequencing was performed on an Illumina MiSeq sequencer using MiSeq Reagent Kit v2 (500-cycles ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA libraries were prepared using 1 µg of total RNA using the TruSeq RNA Sample Preparation Kit v2 (Illumina). RNA quality was assessed by an Agilent Bioanalyzer 2100 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cDNA was diluted to an average of 200 pg/µl and 100 pg cDNA from each cell was tagmented by adding 1 µl TD and 0.5 µl ATM from a Nextera XT DNA Library Preparation Kit (Illumina) to 0.5 µl diluted cDNA in each well of a fresh 384-well plate ...