Labshake search
Citations for Illumina :
51 - 100 of 9024 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina HiSeq2500 in 50bp single-read mode.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was prepared using the manufacturers protocol (Chromium Single Cell 3’ reagent kits kit v3, 10x Genomics) and sequenced on a Novaseq 6000 instrument (Illumina). After sample processing and quality control analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... with ribosomal depletion using Human/Mouse/Rat Ribo-Zero kit (Epicentre/Illumina). All samples were sequenced using a 100 base-pair (bp ...
-
bioRxiv - Developmental Biology 2023Quote: ... TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) was used to prepare RNA-seq libraries according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Physiology 2021Quote: Sodium-bisulfite treated DNA of nine samples (6 dHT vehicle treated and 3 dHT drug treated) was subjected to measure global DNAm by Infinium Mouse methylation BeadChip array (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: The 200 µL of the lysates described above were treated with RNase I (50 units nuclease per 40 µg of RNA; the nuclease was included in TruSeq Mammalian Ribo Profile Kit, Illumina, RPHMR12126) for 1 hour at room temperature with gentle mixing ...
-
bioRxiv - Neuroscience 2020Quote: ... poly(A) containing mRNA was purified and libraries were prepared using TruSeq Stranded mRNA kit (Illumina). Unstranded libraries with a mean fragment size of 150bp (range 100-300bp ...
-
bioRxiv - Immunology 2023Quote: ... 10% v/v dimethylformamide) containing 1 μl Tagment DNA Enzyme (Nextera DNA Sample Prep Kit (Illumina)) ...
-
bioRxiv - Neuroscience 2019Quote: ... and rRNA-depletion (“Ribo-Zero”; Illumina Ribo-Zero Gold Kit (Human/Mouse/Rat), Cat # MRZG126 ...
-
bioRxiv - Genetics 2020Quote: ... or the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... ribosomal RNA was removed using the Ribo-Zero Human/Mouse/Rat kit (Illumina). Sequencing libraries were generated according to the TruSeq stranded total RNA (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... Both libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD from Illumina, following the standard protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Genetics 2020Quote: ... 3 groups in total) and constructed using the Illumina TruSeq Stranded Small RNA Sequencing kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and 3 μg of the product was processed using the TruSeq RNA Sample Preparation Kit (Illumina). Purification of mRNA was performed using polyT oligo-attached magnetic beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Genomics 2021Quote: ... 2.5 μl Tagment DNA enzyme I (Illumina 15027865), in water ...
-
bioRxiv - Genomics 2021Quote: ... 2.5 µl Tagment DNA enzyme I (Illumina 15027865), and incubated at 37°C for 30 min on a heat block ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.5 μl Tagment DNA enzyme I (Illumina, 15027865), in water ...
-
bioRxiv - Cancer Biology 2022Quote: ... ScRNA-seq libraries were prepared using the Next GEM Chromium single cell 3′ reagent kits V3.1 with feature barcode technology for cell surface protein (10x genomics) and sequenced using NextSeq 500 high output kits and Novaseq S4 PE100 kits (Illumina). scRNA-Seq data after standard quality control was aligned to the reference genome (mm10 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Cell Biology 2022Quote: ... libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Kit (cat. RS-122-2201/2202, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... rRNA was removed using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) and Ribo-Zero rRNA Removal Kit (Bacteria) (Illumina). In order to reduce the impact of the host transcriptome on subsequent analysis ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Kit (REF. RS-122-2201/2202, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted with a Direct-zol RNA MicroPrep Kit and subjected to RNA-Seq library preparation using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) followed by a TruSeq Stranded Total RNA Kit (Illumina).
-
bioRxiv - Genomics 2019Quote: ... Frozen nuclear pellets of 2.5 × 104 PSCs were thawed on ice and tagmented in total volume of 25μl in permeabilization buffer containing digitonin and 2.5μl of Tn5 from Nextera DNA Library Preparation Kit (Illumina) for 45-75min at 37°C in a thermomixer (500 RPM shaking) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The nuclei were centrifuged at 500g for 5 minutes at 4°C and subsequently resuspended on ice in 50μl transposase reaction buffer containing 2.5μl of Tn5 transposase and 25μl of 2xTD buffer (Nextera DNA Sample preparation kit from Illumina). After incubation at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2020Quote: ... resuspended in 50 μl 1xTD buffer containing 2.5 μl TDE1 transposase (Illumina Nextera DNA Sample Preparation Kit), and incubated for 30 min at 37°C ...
-
bioRxiv - Plant Biology 2020Quote: ... Libraries were pooled and sequenced with 3 runs on the MiSeq using the reagent kit V2 (Illumina).
-
bioRxiv - Cell Biology 2022Quote: ... Ribosomal RNA was removed by Illumina Ribo-Zero Gold rRNA Removal Kit Human/Mouse/Rat (Illumina, San Diego, CA, USA) and stranded total RNA-seq libraries were prepared using the Illumina TruSeq RNA Sample Preparation v2 Kit (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA-depleted by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina), and reverse transcribed by ProtoScript II Reverse Transcriptase (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... The Ribo-Zero Gold (Human/Mouse/Rat) and (Yeast) kit (Illumina, San Diego, CA) were used to deplete rRNA using 300 ng total RNA as input ...
-
bioRxiv - Genomics 2019Quote: ... 10% v/v dimethylformamide) containing 1 μl Tagment DNA Enzyme from the Nextera DNA Sample Prep Kit (Illumina) and incubated at 37°C for 10 min followed by 2x washing in RIPA-LS and TE (10mM Tris-HCL ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library of polyA-containing mRNA (350 bp size) was prepared using TruSeq Stranded mRNA Library Prep kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... sequencing libraries were prepared from 1 ng gDNA using the Nextera XT Library Preparation Kit v.3 (Illumina) and sequenced on the Illumina NextSeq system (paired end 2 x 150 bp insert size) ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR products were gel purified in 3% agarose gel and qPCRed (using NEBNext Library Quant Kit for Illumina) to quantify concentration ...
-
bioRxiv - Genomics 2021Quote: ... Single-cell libraries were prepared using the SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina). The quality of the libraries was assessed using the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Neuroscience 2022Quote: ... Gene expression and barcode libraries were prepared in parallel using the Chromium Next GEM Single Cell 3’ Kit v3.1 (10x Genomics) according to manufacturer’s instructions and sequenced in a Novaseq 6000 system (Illumina). A detailed step-by-step protocol can be found on protocols.io ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared using the QuantSeq 3′mRNA-Seq Library Prep Kit-FWD by Illumina (Lexogen, Vienna, Austria), using 500 ng of total RNA ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μg of total RNA samples underwent treatment with the epicenter Ribo-ZeroTM Kit (Illumina, San Diego, USA) to remove rRNA ...