Labshake search
Citations for Illumina :
201 - 250 of 363 citations for Mouse Anti MERS Coronavirus Spike S1 Antibody 3871 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... We confirmed all strains had marker-less deletions by PCR followed by Sanger sequencing (primers given in Table S1) and Next Generation Sequencing (Illumina HiSeq PE150, >30x coverage). We used P1 transduction to transfer modifying enzyme (ME ...
-
bioRxiv - Microbiology 2023Quote: DNA samples were sent for amplicon sequencing of the V6-V8 16S rRNA region using staggered primers (Table S1) by the Genome Quebec Innovation Centre using an Illumina MiSeq platform (Illumina Inc., San Diego, CA) and analyzed using an established QIIME 2 pipeline (21 ...
-
bioRxiv - Genomics 2020Quote: Messenger RNA capture based libraries were prepared starting from 8.5 µL DNase treated and spike-in supplemented RNA eluate using the TruSeq RNA Exome Library Prep Kit (Illumina, San Diego, CA, USA). Each sample underwent individual enrichment according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% ϕX174 spike-in and sequenced on an Illumina MiSeq instrument with a Reagent Kit v3 (Illumina #MS-102-3001), reading 169 nt for read 1 and 6 nt for the P7 index read.
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5’ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... Purified libraries were sequenced on Illumina MiSeq platform (reagent kits: v2 300-cycles, paired-end mode) at 8 pM loading concentration with 25% PhiX spike-in (Illumina FC-110-3001). Custom sequencing primers were spiked into reagent cartridge (well 12 ...
-
bioRxiv - Systems Biology 2023Quote: ChIP-seq and input libraries were sequenced on the Illumina NextSeq 500 system with a ∼20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Microbiology 2023Quote: ... (Text S1.), while sequencing was performed at the Swedish National Genomics Infrastructure (NGI) (Uppsala, Sweden) on Illumina MiSeq platform (Illumina Inc, San Diego, CA, USA) in a 2×300 bp paired-end format and with v3 chemistry.
-
bioRxiv - Immunology 2019Quote: ... The eight capture pools were then pooled equimolar and sequenced across two Illumina HiSeq2500 v2 150bp single-end rapid lanes with a ten percent PhiX control library spike (Illumina Inc., San Diego, CA). Basecall files (bclfiles ...
-
bioRxiv - Genomics 2020Quote: Small RNA libraries were prepared starting from 5 µL DNase treated and spike-in supplemented RNA eluate using a TruSeq Small RNA Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol with two minor modifications(1) ...
-
bioRxiv - Genomics 2021Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike (PhiX Control v3 Illumina Catalogue FC-110-3001).
-
bioRxiv - Genomics 2022Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1 % PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Data was uploaded to Basespace (www.basespace.illumina.com ...
-
bioRxiv - Microbiology 2023Quote: ... The library was then diluted to a concentration of 15 pM and sequenced with a 15% PhiX spike-in on an Illumina MiSeq sequencing platform using the MiSeq Reagent Kit v3 (600 cycles) (Illumina, Inc., San Diego, CA). The resulting read lengths were 301 bp (forward sequences) ...
-
bioRxiv - Immunology 2024Quote: ... The libraries were then pooled at 5nM and sequenced on an Illumina NextSeq 2000 instrument at a 600pM input and 2% PhiX spike in using a P3 100 cycle flow cell (Illumina, San Diego, CA, USA) resulting in 36000-58000 reads per cell.
-
bioRxiv - Microbiology 2020Quote: ... WGS libraries were sequenced with paired-end 150 base pair reads on an Illumina NovaSeq 6000 by the UW Biotechnology Center (Illumina NovaSeq 6000 S1 Reagent Kit v1.5).
-
bioRxiv - Neuroscience 2023Quote: ... A total of six libraries of samples were pooled at 12 pM with 1% PhiX spike-in and paired-end sequenced with Illumina MiSeq system using Illumina MiSeq Reagent Kit v3 (150-cycle) (Illumina, United States, MS-102-3001). An average of 5.60 Gb data was obtained from 1849.27 K/mm2 mean cluster density in each sequencing run on MiSeq ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human/Mouse/Rat (Illumina, discontinued), and fragmented by incubating with PNK buffer (NEB ...
-
bioRxiv - Genomics 2019Quote: ... mouse and rat (Illumina, USA). Sequencing has been done with 2×250 bp paired-end on a HiSeq 2500 (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... For Infinium Mouse Methylation BeadChip (Illumina) arrays ...
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Genetics 2023Quote: ... The mm10 mouse genome manifest from Illumina was used as reference ...
-
bioRxiv - Genomics 2020Quote: ... and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse GRCm38/mm10 genome annotation was accessed from Illumina’s iGenomes repository (available at https://support.illumina.com/sequencing/sequencing_software/igenome.html ...
-
bioRxiv - Cancer Biology 2019Quote: ... and TruSeq Stranded Total RNA Human/Mouse/Rat (Illumina, 20020596) with 100 ng of input and 13 PCR cycles ...
-
bioRxiv - Genetics 2019Quote: ... the Ribo-Zero rRNA Removal kit (Human/Mouse/Rat, Illumina) was employed to deplete ribosomal RNA from 20 µg of total human or mouse brain RNA according to the manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Ribo-Zero rRNA Removal Kit (Illumina human/mouse/rat) was applied to remove the rRNAs ...
-
bioRxiv - Cell Biology 2023Quote: ... Infinium Mouse Methylation BeadChip (Illumina, Inc., San Diego, CA, USA) arrays were used to profile DNA methylation genome wide ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina Ribo Zero Gold for human/mouse/rat kit (Illumina) was used to remove rRNA during sample preparation per manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) was used.
-
bioRxiv - Genomics 2019Quote: ... with Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). The cDNA libraries from human and mouse samples were sequenced on the Illumina HiSeq 2500 and Illumina NextSeq 500 platforms ...
-
bioRxiv - Neuroscience 2023Quote: ... and then aligned to the mouse genome using Top-Hat (Illumina) and fragments were assigned to genes using the FeatureCounts program (iCONICS core facility ...
-
bioRxiv - Molecular Biology 2020Quote: ... with ribosomal depletion using Human/Mouse/Rat Ribo-Zero kit (Epicentre/Illumina). All samples were sequenced using a 100 base-pair (bp ...
-
bioRxiv - Genomics 2020Quote: ... Illumina TruSeq Stranded Total RNA Ribo-Zero Human/Mouse/Rat Gold (Illumina) was used to construct ribosomal RNA depleted sequencing libraries ...
-
bioRxiv - Developmental Biology 2023Quote: ... TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) was used to prepare RNA-seq libraries according to manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (2016) sequenced mouse whole genomes to 11-26x coverage (Illumina HiSeq 2000) from natural populations of house mouse (Mus musculus) ...
-
bioRxiv - Cell Biology 2023Quote: ... RNase H or the Ribo-Zero method (human, mouse, plants) (Illumina, USA) was used to remove rRNA ...
-
bioRxiv - Neuroscience 2019Quote: ... and rRNA-depletion (“Ribo-Zero”; Illumina Ribo-Zero Gold Kit (Human/Mouse/Rat), Cat # MRZG126 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sequences were mapped to the reference mouse genome (mm9) with ELAND v2 (Illumina). Only uniquely mapped tags with no base mismatches were used for the analysis ...
-
bioRxiv - Genetics 2020Quote: ... or the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... Genome-wide DNA methylation was analyzed using the Infinium Mouse Methylation BeadChip (Illumina). Methylation data were acquired using the iScan system and processed using GenomeStudio 2.0 (Illumina) ...
-
bioRxiv - Genomics 2022Quote: ... ribosomal RNA was removed using the Ribo-Zero Human/Mouse/Rat kit (Illumina). Sequencing libraries were generated according to the TruSeq stranded total RNA (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: We used the Illumina Infinium Mouse Methylation BeadChip (Illumina, San Diego, CA, USA) to measure DNAm across the whole mouse epigenome in accordance to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: DNA methylation was analyzed using Infinium Mouse Methylation BeadChip (MMBC) Array from Illumina. DNA for MMBC (500 ng in 40 μL nuclease-free water ...
-
bioRxiv - Cell Biology 2022Quote: ... Ribosomal RNA was removed by Illumina Ribo-Zero Gold rRNA Removal Kit Human/Mouse/Rat (Illumina, San Diego, CA, USA) and stranded total RNA-seq libraries were prepared using the Illumina TruSeq RNA Sample Preparation v2 Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... All RNA samples were treated with RiboZero (Human/Mouse/Rat) (Illumina, San Diego, CA) for the depletion of ribosomal RNA ...
-
bioRxiv - Genomics 2019Quote: ... The reads were aligned to the mouse reference genome (mm10) with Isaac aligner (Illumina). Duplicated reads were identified and removed with Picard (http://broadinstitute.github.io/picard/) ...
-
bioRxiv - Genetics 2020Quote: RNA-seq libraries (TruSeq® Stranded Total RNA Library Prep Human/Mouse/Rat, Illumina) were prepared from 150 ng of previously isolated viral RNA according to the manufacturers’ protocol ...