Labshake search
Citations for Illumina :
501 - 550 of 992 citations for Lassa Fever Virus GP2 Protein Human Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Libraries were pooled in equimolar concentrations and sequenced using an Illumina NextSeq 500/550 sequencer (Illumina, FC-404-2005). At least 95% of the reads generated presented a Q score of ≥ 30 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were added with 50mL trans-position reaction mix of Nextera DNA library preparation kit (FC-121-1031, Illumina). DNA was amplified by PCR and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Tagmentation and indexed library amplification were done with Nextera® XT DNA Library Preparation Kit (Illumina, FC-131-1096) and Nextera® XT Index Kit (96 indexes ...
-
bioRxiv - Immunology 2024Quote: ... Two arrays were sequenced per sequencing run with an Illumina 75 Cycle NextSeq500/550v2 kit (Illumina FC-404–2005) at a final concentration of 2.4 pM ...
-
bioRxiv - Microbiology 2024Quote: ... This PCR product was prepared for sequencing using the Nextera XT DNA Sample Prep Kit (Illumina, FC-131-1096) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from Epstein–Barr-virus-transformed lymphoblastoid cell lines (LCLs) by following the Illumina TruSeq v2 RNA Sample Preparation protocol (Illumina, Inc., San Diego, CA) by the Department of Genetic Medicine and Development at the University of Geneva ...
-
bioRxiv - Genetics 2020Quote: ... MS-103-2003) at a concentration of 15 nM with addition of 15% Phix control v3 (Illumina, FC-11-2003). The Illumina Mi-Seq post-run processing uses the barcoded indices to split all sequences by sample and generate FASTQ files ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then indexed using forward (i7) and reverse (i5) index primers from the Nextera Index Kit (Illumina FC-121-1011). Index ligation and fragment amplification were achieved using the method’s PCR amplification thermal cycling program.
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mono-nucleosomal DNAs were subjected to sequencing using a TruSeq DNA library prep kit (FC-121-2001, Illumina). The final libraries were sequenced using an Illumina HiSeq 2500 platform ...
-
bioRxiv - Molecular Biology 2021Quote: ... Tagmentation of 600pg of cDNA is performed according to Nextera DNA sample preparation manufacturer instructions (Illumina, Inc., FC-131-1096) using a Truseq-P5 hybrid constant oligo (IDT ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Developmental Biology 2019Quote: ... quantification and Nextera library construction were done following the published ChIPmentation protocol (Schmidl et al., 2015) using indexed Illumina adapters (FC-121-1011, Illumina). Illumina adaptors were removed from the ChIP and ChIPmentation reads using Cutadapt (1.6 ...
-
bioRxiv - Systems Biology 2020Quote: cDNA was tagmented and amplified using the Nextera XT DNA Library Preparation Kit (FC-131-1096, Illumina, San Diego, CA). The manufacturer’s protocol was followed with the following modified reagent volumes and primers ...
-
bioRxiv - Immunology 2019Quote: ... and by enzymatic fragmentation of 300 pg of cDNA followed by 12 PCR cycles using the Nextera XT DNA Library Preparation Kit (cat# FC-131-1096, Illumina). Sequencing of the 15 mRNAseq libraries multiplexed together was carried out with an Illumina HiSeq2500 on a 2x125 bp paired-end run.
-
bioRxiv - Genomics 2019Quote: ... Each sample library was uniquely barcoded and quantified by PCR using a PhiX Control v3 (Illumina, Cat #FC-110-3001) standard curve ...
-
bioRxiv - Genetics 2020Quote: ... MS-103-2003) at a concentration of 15nM with the addition of 15% Phix Control v3 (Illumina, FC-11-2003) previously described by Shaukat et al ...
-
bioRxiv - Genomics 2020Quote: ... was performed on the instrument using HiSeq Rapid SBS Kit v2 (FC-402-4021) and HiSeq Rapid PE Cluster Kit v2 (PE-402-4002) (Illumina). Image analysis was performed using the HiSeq Control Software version 2.2.58 ...
-
bioRxiv - Genetics 2020Quote: ... The cell pellet was resuspended with 50 μl transposition mix containing 25 μl 2X TD buffer (Illumina FC-121-1030), 3.5 μl Tn5 transposase (Illumina FC-121-1030) ...
-
bioRxiv - Cell Biology 2021Quote: ... was performed by incubating beads with tagmentation buffer (12.5 µl 2 x TD buffer, 11.5 µl nuclease free water, 1µl Tn5 enzyme (Illumina #FC-131-1024)) at 37°C for 10min ...
-
bioRxiv - Genomics 2021Quote: ... The nuclei-enriched pellet was immediately used for transposition reaction using Nextera DNA Library Prep Kit (Illumina, FC-121-1030). The transposition reaction was incubated at 370C for 30 min and followed immediately by purification using QIAGEN MinElute Kit (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: ... NGS libraries were prepared using 150 pg of cDNA input and the Nextera XT DNA Library Preparation Kit (catalog FC-131-1024, Illumina) with 11 cycles of PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 bases for index 1 and 8 bases for index 2) using the NextSeq 500 High Output Kit 75-cycles (#FC-404-1005, Illumina) loaded at 1.8pM and including 1 % PhiX ...
-
bioRxiv - Plant Biology 2020Quote: ... Nuclei pellets were collected as described previously by centrifugation at 1,000 × g and tagmented with Nextera DNA Library Prep Kit (Illumina, catalog number: FC-121-1030, now discontinued; replacement can be found as Illumina Tagment DNA TDE1 Enzyme and Buffer Kits ...
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Genomics 2022Quote: ... A paired-end library was prepared with the TruSeq DNA PCR-Free LT Sample Preparation Kit (Illumina, #FC-121-3001) from 1 µg of the genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... MS-103-2003) at a concentration of 15nM with the addition of 15% Phix Control v3 (Illumina, FC-11-2003) described by Chaudhry et al ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Neuroscience 2021Quote: ... ~600 pg of purified cDNA was used to produce a RNA-seq library using Nextera XT DNA Library Preparation kit (FC-131-1024, Illumina), following the manufacturer instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... tagmentation was carried out on double-stranded cDNA using the Nextera XT Library Sample Preparation kit (Illumina, FC-131-1096). Each well was mixed with 0.8 µl Nextera tagmentation DNA buffer (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... 100ng of full-lentgth cDNAs are used as input to the Nextera DNA Sample Prep kit (ref FC-121-1030, Illumina) which enriches for 3′ends of cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The sequencing library was prepared using the Illumina TruSeq RNA Sample Prep Kit (FC-122-1001; Illumina, San Diego, CA) with 1 ug of total RNA ...
-
bioRxiv - Cancer Biology 2022Quote: Sequencing libraries were constructed from the cDNA using the Illumina Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). The cDNA library was sequenced on the NovaSeq 6000 instrument using 150-bp paired-end reads.
-
bioRxiv - Developmental Biology 2022Quote: ... RNA-seq libraries were sequenced for 75 cycles in single-end mode on NextSeq 500 platform (Illumina, FC-404-2005).
-
bioRxiv - Cell Biology 2019Quote: Purified cDNA (75 ng) was used as input to the Nextera XT DNA library preparation kit (Illumina, FC-131- 1096), following the manufacturers protocol with the modification of using 1:5 of reagent volumes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were pooled and tagmentation performed using the Illumina Nextera XT DNA sample preparation kit (Illumina Cat #FC-131-1024), libraries pooled and sequenced on a HiSeq 2000.
-
bioRxiv - Genetics 2019Quote: ... Samples were sequenced using 2×75bp paired-end with the NextSeq 500/550 Mid Output v2 kit (150 cycles; Cat. No. FC-404-2001) on an Illumina NextSeq500 Sequencer (Illumina). Sequencing was performed by the Genome Research Hub at Cardiff University ...
-
bioRxiv - Genomics 2019Quote: Single cell calling card library preparation was performed using the Nextera Mate Pair Sample Prep Kit (Illumina #FC-132-1001) with modifications to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: Calling card libraries from bulk RNA were generated using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1024). One nanogram of PCR product was resuspended in 5 µl ddH2O ...
-
bioRxiv - Genomics 2020Quote: ... and pooled in equal concentrations prior to MiSeq v3 sequencing with 15% phiX control spike-in (Illumina FC-110-3001).
-
bioRxiv - Genetics 2020Quote: ... Transposition reaction was performed according the manufacturer’s protocol for Nextra Tn5 transpoase Nextra kit (Illumina, Cat. No.: FC-121-1030). Transposed DNA fragments were purified by Qiagen MiniElute PCR purification kit (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and mate-pair libraries of 3 kb and 6 kb insert sizes were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We then assessed library quality using the HS DNA Kit (Agilent ...
-
bioRxiv - Genomics 2021Quote: ... and each sample was uniquely indexed using Nextera XT Index Kit V2 indexing primers (Illumina, Cat. No. FC-131-2001). Indexed libraries were purified with Omega Mag-Bind Total Pure NGS Beads ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and mate-pair libraries of 3 kb insert size were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We then assessed library quality using the HS DNA Kit (Agilent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Approximately 30% of Illumina libraries were constructed in-house with the Nextera DNA Library Preparation Kit (Illumina, FC-121-1030) using a protocol based off of previously published protocols51,52 ...
-
bioRxiv - Microbiology 2020Quote: ... Dual-indexed sequencing libraries were prepared from the lysates using Nextera XT DNA Library Preparation Kit (Illumina FC-131-1096), and sequenced on an Illumina Miseq benchtop sequencer (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... Sequencing was carried out by running 150 cycles on Illumina HiSeq 2500 using TruSeq Rapid SBS Kit (FC-402-4001, Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... Pooled libraries were sequenced using the NextSeq 500/550 High Output Kit v2 for 75 cycles (Illumina FC-404-2005). Base calling accuracy was greater than 80% (>=Q30 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Sequencing libraries were prepared from 1µg DNA using the TruSeq PCRfree DNA sample preparation kit (cat# FC-121-3001/3002, Illumina Inc.) targeting an insert size of 350bp ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Genomics 2019Quote: ... single-end mode) at 12 pM loading concentration with 10% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions.