Labshake search
Citations for Illumina :
51 - 99 of 99 citations for L Alanine N T Boc 13C3 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using the configuration 28-8-98 on a single-index-paired-end run ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA integrity was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA 95051 USA. mRNA was isolated using poly T beads, whereafter Illumina libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using 100 bp paired-end run at a depth of 65-100 million reads ...
-
bioRxiv - Microbiology 2024Quote: ... Raw genomic reads obtained by Illumina HiSeq 2500 and NovaSeq 6000 (for D. grisea, E. coxiae, Galdieria sp. ACUF 613, M. erythrocladioides, P. aerugineum, and T. oligopyrenoides) and by Illumina HiSeq 2500 and NovaSeq 6000 plus Oxford Nanopore MinION Mk 1B (for R ...
-
bioRxiv - Genetics 2024Quote: ... we aligned the corresponding short reads to the human reference GRCh38 using bwa mem23 (v 0.7.17-r1188; -t 48 -R “@RG\tID:1\tLB:lib1\tPL:ILLUMINA\tSM:
\tPU:unit1”). Next ... -
bioRxiv - Cell Biology 2019Quote: ... The sequencing libraries were quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) and Qubit 3.0 with dsDNA HS Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... 30 libraries (n=15 for each group) were constructed using the HiSeq Library Preparation kit (Illumina, San Diego, USA) and sequenced using Illumina NovaSeq™ ...
-
bioRxiv - Cancer Biology 2022Quote: mRNA libraries of the mouse melanoma tumor (n = 12) samples were prepared and sequenced using the HiSeq 2000 (Illumina). RNAseq data were processed by pyflow-RNAseq (Tang ...
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Cancer Biology 2023Quote: ... All samples were pooled equimolarly and sequenced on a NextSeq 500 High Output v2.5 flowcell (Illumina p/n 20024906) using the Illumina NextSeq 500 sequencing instrument with a single-read configuration (75 bp) ...
-
bioRxiv - Zoology 2023Quote: ... construction using the ONT rapid barcoding kit (SQK-RBK004 or SQK-RBK110.96) or an Illumina MiSeq (n=257) using the Nextera XT Library Preparation kit (Illumina) following the manufacturers’ protocol ...
-
bioRxiv - Genomics 2020Quote: Whole-genome DNA methylation measurement was performed on DNA from purified CD4+ T cells using Infinium MethylationEPIC BeadChip (Illumina 850K array) by the Center for Applied Genomics Genotyping Laboratory at the Children’s Hospital of Pennsylvania ...
-
bioRxiv - Genetics 2024Quote: The process of library construction involved the purification of messenger RNA from total RNA using magnetic beads attached to poly-T oligos (TruSeq RNA Sample Prep Kit v2, Illumina Inc.). Subsequently ...
-
bioRxiv - Developmental Biology 2022Quote: ... The barcode sequencing libraries were quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824). Sequencing libraries were loaded at 18 pM on an Illumina HiSeq2500 using the following read length ...
-
bioRxiv - Cancer Biology 2020Quote: The RNA-seq libraries (n=3 per experimental group) were prepared using the NEBNext Ultra II RNA library prep kit from Illumina (New England Biolabs Inc. ...
-
bioRxiv - Genomics 2020Quote: ... The normalised samples (4 nM) were denatured with 0.2 N NaOH and diluted 20 pM using pre-chilled Hybridisation Buffer (HT1) (Illumina, USA). The 20 pM transcriptome libraries were further diluted to 10 pM with pre-chilled HT1 buffer prior to whole transcriptome sequencing on a MiSeq platform.
-
bioRxiv - Cancer Biology 2020Quote: Capture-based next-generation DNA sequencing for cases with sufficient material (n=18) was performed on a NextSeq 500 instrument (Illumina) as previously described13 using a custom brain tumor panel covering the entire coding and selected intronic and promoter regions of 130 or 160 genes of particular relevance in central nervous system tumors ...
-
bioRxiv - Cancer Biology 2022Quote: All 450K array methylation level files were downloaded (Data Type: “Methylation beta value”, Platform: “Illumina Human Methylation 450”; n = 507). The average CpG methylation level over DMRs identified in this study and GENCODE transcript promoters was calculated in all TCGA LUAD and matched normal samples ...
-
bioRxiv - Genomics 2022Quote: All samples (n=75) underwent 16S rRNA gene sequencing using 515F-806R primers on the MiSeq (Illumina, San Diego, USA) as previously described (Seaton et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-seq libraries for yeast (n = 3 per tested condition) and neuroblastoma cells (n = 3 per tested condition) were prepared according to the TruSeq stranded mRNA protocol (Illumina) and 101-bp single-end reads produced on an Illumina NovaSeq 6000 instrument ...
-
bioRxiv - Microbiology 2023Quote: ... and colonising (clinical non-CAPA) (C402, C404-C407, C409, C410) isolates from the Netherlands (n=9) were sequenced using NextSeq 550 sequencer (Illumina), and 218 UK and Irish isolates and the five IA isolates (C307 ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from 500 µl of O/N cultures using the Epicentre MasterPureTM DNA purification kit (Illumina Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... was obtained using featureCount (v2.0.2; options: -L for ONT-DRS and -p for Illumina reads).
-
bioRxiv - Microbiology 2023Quote: Hybridization capture was performed with an Illumina RNA Prep with Enrichment (L) Tagmentation kit (Illumina #20040537), IDT for Illumina DNA/RNA UD Indexes (Illumina #20027213) ...
-
bioRxiv - Genomics 2020Quote: ... was prepared from total RNA from a testicular tissue sample of one BSW bull homozygous for the mutant T-allele at Chr6:58373887 using the Illumina TruSeq RNA Sample Preparation Kit (Illumina, San Diego, CA, USA). The library was sequenced using an Illumina NovaSeq6000 instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... Library preparation for RNA-Seq was performed using the TruSeq™ RNA Sample Prep Kit v2 (Illumina, Cat. N°RS-122-2002, USA) starting from 50 ng of total RNA ...
-
bioRxiv - Neuroscience 2020Quote: ... Library preparation for RNA-Seq was performed using the TruSeq™ RNA Sample Prep Kit v2 (Illumina, Cat. N°RS-122-2002, U.S.A.) starting from 50 ng of total RNA ...
-
bioRxiv - Microbiology 2019Quote: ... 1 μl of DNA (approximately 0.5-2.0 ng/μl) was used in the tagmentation reaction using Nextera chemistry (Illumina) to yield fragments larger than 150 bp ...
-
bioRxiv - Microbiology 2022Quote: ... Pan-viral target hybridization enrichment sequencing was performed by using RNA Prep with Enrichment (L) Tagmentation Kit (Illumina) and Comprehensive Viral Research Panel (Twist Biosciences).
-
bioRxiv - Genomics 2020Quote: ... Individual libraries for each of the analyzed bovines (N=16) were processed using the TruSeq Stranded mRNA Preparation kit (Illumina, San Diego, CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... RNA was extracted from similar pooled-samples (N = 3) using the ZYMO (Irvine, CA, USA) direct-zol miniprep kit (Cat. # R2050) and sequenced using NovaSeq (Illumina, San Diego, CA, USA) paired-end (150 bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclei were pelleted and resuspended in 1x TD with 2.5 l TDE1 (Nextera DNA library prep kit, Illumina). These were incubated for 30 min at 37oC ...
-
bioRxiv - Genetics 2020Quote: ... were incubated in a 50 µl reaction with 0.8 µl of Tn5 transposase at 1× TD buffer from the Nextera library preparation kit (Illumina) for 5 min at 55°C ...
-
bioRxiv - Genetics 2020Quote: The phage L cI−40 13−am43 genome was sequenced at New England Biolabs by combining data from Illumina and PacBio RS2 methods ...
-
bioRxiv - Developmental Biology 2024Quote: ... Pellets were resuspended in 50 µL of transposition reaction (2X TD buffer, 1X PBS, 0.1% Tween-20, 0.1% Digitonin, 5µL of Illumina Tn5 transposase) and incubated for 30 min at 37°C with 1,000 rpm agitation ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA purified from hippocampi of WT and Atf6b−/− mice (n=2 per group) was used to prepare RNA libraries using a TruSeq Stranded mRNA Sample Preparation Kit (Illumina, Inc., San Diego, CA, USA), with polyA selection for ribosomal RNA depletion ...
-
bioRxiv - Cell Biology 2022Quote: ... Tagmentation products were amplified by PCR by adding 1.25 µl of each N and S primers (Illumina Nextera XT 96-index kit FC-131- 1002) and 3.75 µl of NPM solution and using the following thermocycler settings ...
-
bioRxiv - Microbiology 2024Quote: ... and controls (n=30) were amplified using PCR with the F515 and R806 primer pair and sequenced using Illumina MiSeq platform (Illumina Inc., San Diego, CA, USA) (82) ...
-
bioRxiv - Plant Biology 2020Quote: ... a 200 µL aliquot of RNA was treated with 50 units of nuclease provided by the ARTSeq/TruSeq Ribo Profile kit (Illumina) for an hour at 23°C on a nutator ...
-
bioRxiv - Systems Biology 2020Quote: For library preparation up to 700 pg cDNA was desiccated and rehydrated in 1 µl Tagmentation mix (1x TruePrep Tagment Buffer L, 0.1 µl TruePrep Tagment Enzyme V50; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme) and tagmented at 55°C for 5 min ...
-
bioRxiv - Immunology 2021Quote: For library preparation up to 700 pg cDNA was desiccated and rehydrated in 1 µl Tagmentation mix (1x TruePrep Tagment Buffer L, 0.1 µl TruePrep Tagment Enzyme V50; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme) and tagmented at 55°C for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... 1.5 ng cDNA was tagmented using 0.5 μl TruePrep Tagment Enzyme V50 and 1x TruePrep Tagment Buffer L (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme), followed by an incubation step at 55 °C for 10 min ...
-
bioRxiv - Genomics 2021Quote: ... 37 μL of the products was diluted to 50 μL of standard Phusion polymerase reaction mix in GC buffer with 0.1 μM primer M1 (annealing to the Illumina PE1.0 primer) and one of indexing primers M2,3 ...
-
bioRxiv - Genetics 2021Quote: ... 50,000 nuclei were incubated in the transposition reaction mix (20μl nuclease-free water; 25μl 2X Tagment DNA Buffer, Illumina Cat#FC-121-1030; 5μl Tn5 Transposase, Illumina Cat#FC-121-1030) at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2.5 µL Tn5 transposase and 22.5 µL nuclease-free H2O) using reagents from the Nextera DNA library Preparation Kit (Illumina #FC-121-103). Samples were then incubated at 37°C for 30min ...
-
bioRxiv - Genomics 2020Quote: ... Multiple adapters were used for pooling libraries (KAPA Single-Indexed Adapter Kit KK8700 and NEBNext® Multiplex Oligos for Illumina NEB #E7535S/L). The DNA samples were sequenced using the Illumina NextSeq 500 platform and 150-nucleotide single-end reads were generated ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequencing libraries were generated by Genomescan using the NEBNext Low Input RNA Library Prep Kit from Illumina (New England Biolabs, cat#E6420S/L). In short ...