Labshake search
Citations for Illumina :
101 - 150 of 590 citations for Kallikrein 3 PSA Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Sequencing of the pooled libraries was completed by the NIDDK Genomics Core on an Illumina NextSeq 550 system using a NextSeq 150 Cycle Hi-Output v2.5 kit (Illumina #20024907), generating a total of 400 million reads for an estimated sequencing depth of 40,000 reads per cell ...
-
bioRxiv - Genomics 2019Quote: ... Two 3rd instar larvae were selected for Hi-C library construction and then sequenced on a HiSeq 2500 platform (Illumina). In addition ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Hi-C libraries were processed to paired-end sequencing on the Illumina Hiseq 4000 (Illumina, San Diego, CA, USA) platform with read length of 150 bp.
-
bioRxiv - Genetics 2022Quote: ... Variants considered causative were validated in the proband and studied in his parents by deep amplicon sequencing performed using Nextera XT Kit (Illumina) and paired-end sequencing as described above for WES.
-
bioRxiv - Genetics 2023Quote: ... Samples were indexed and pairs for each experiment were pooled for sequencing using the NextSeq 500/550 Hi Output KT v2.5 (Illumina #20024907) on an Illumina NextSeq550 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were pooled at a concentration of 5 nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Genomics 2024Quote: The chromatin conformation capture (Hi-C) fragment libraries were constructed from 300-700 bp insert size and were measured by Illumina platform for auxiliary assembly (Rao et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Genomics 2020Quote: ... Human libraries were sequenced on a NovaSeq 6000 (Illumina) and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA expression log intensity levels (Illumina Human v3 microarray) were used as the expression levels of the genes ...
-
bioRxiv - Developmental Biology 2019Quote: ... Four nM samples were pooled and run on a NextSeq 500/550 Hi Output Kit (20024907, Illumina, Inc. San Diego, CA) and the NextSeq 500 Illumina Sequencer to obtain paired end reads of 75bp ...
-
bioRxiv - Plant Biology 2021Quote: ... The chimeric fragments were isolated and then constructed to five Hi-C libraries that were sequenced on an Illumina NovaSeq platform (Illumina, USA) with 2×150 bp pair-end reads ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were sequenced single-end using 50 bp reads on the HiSeq-2500 and Hi-Seq 4000 platforms (Illumina, San Diego, USA).
-
bioRxiv - Genetics 2022Quote: ... Final library concentrations were diluted to 4nM and submitted for sequencing on the Illumina Hi-Seq 2500 (Illumina, San Diego, CA, USA), 125bp SE in the GSL ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cDNA libraries were singe-end sequenced in 76 cycles using a NSQ 500/550 Hi Output KT v2.5 (Cat #20024906 Illumina, San-Diego, CA) in one multiplex run (N=3/exposure group) ...
-
bioRxiv - Cancer Biology 2021Quote: The Illumina Infinium Human Methylation 450k BeadChip (Illumina 450K array) prostate adenocarcinoma dataset was downloaded from the TCGA consortium database ...
-
bioRxiv - Genetics 2019Quote: ... and genotyped on the Infinium Human CoreExome-24 BeadChip (Illumina). Variants missing >5% of total genotypes and variants that deviated from Hardy-Weinberg equilibrium were removed ...
-
bioRxiv - Cancer Biology 2019Quote: ... and TruSeq Stranded Total RNA Human/Mouse/Rat (Illumina, 20020596) with 100 ng of input and 13 PCR cycles ...
-
bioRxiv - Genetics 2019Quote: ... the Ribo-Zero rRNA Removal kit (Human/Mouse/Rat, Illumina) was employed to deplete ribosomal RNA from 20 µg of total human or mouse brain RNA according to the manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The Illumina Infinium® human 450k (Illumina, WG-314-10031) and EPIC methylation (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... IM and YA using the Sentrix Human CNV370 BeadChip (Illumina) and analysed using GenomeStudio software.
-
bioRxiv - Molecular Biology 2022Quote: ... The Ribo-Zero rRNA Removal Kit (Illumina human/mouse/rat) was applied to remove the rRNAs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina Ribo Zero Gold for human/mouse/rat kit (Illumina) was used to remove rRNA during sample preparation per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Genomics 2019Quote: ... and purified before being sequenced with 100-bp single-end using the Illumina Hi-Seq 2500 sequencing platform (Illumina, San Diego, CA, U.S.A.).
-
bioRxiv - Cell Biology 2021Quote: ... Eluted libraries were quantified using a Qubit dsDNA HS Assay Kit and sequenced on a NextSeq 500 or Hi-Seq 4000 (Illumina, San Diego, California). A list of the RNA-Seq samples can be found in Supplementary Table 5.
-
bioRxiv - Developmental Biology 2020Quote: ... The samples were pooled at a concentration of 5nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina, Inc. San Diego, CA) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Immunology 2019Quote: ... Non-stranded sequencing libraries were prepared using Illumina TruSeq RNA library kits and sequenced on an Illumina Hi Seq2500 using a SE70 protocol (Illumina, San Diego, CA). Raw sequenced reads were trimmed for adapter and bar-codes sequences and quality assessed using FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) ...
-
bioRxiv - Genetics 2019Quote: ... DNA was submitted to the Huntsman Cancer Institute High Throughput genomic core for sequencing on a Hi-Seq 2500 (Illumina, San Diego, CA) using 50 cycle-single read chemistry ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... multiplexed and sequenced as 150 bp paired-end reads using two lanes on an Illumina Hi-Seq 2000 (Illumina, San Diego, CA, USA) through Novogene (Beijing ...
-
bioRxiv - Cell Biology 2023Quote: ... were used instead of the primers that came with the SMARTer Stranded Total RNA HI Mammalian kit to allow for sequencing on the NovaSeq (Illumina, San Diego, CA) by the Biopolymers Facility at Harvard Medical School.
-
bioRxiv - Genomics 2024Quote: ... Hi-C libraries for scaffolding were generated and sequenced by Arima Genomics (200.48 million PE 150-bp reads; Illumina NovaSeq; Arima Genomics, USA). To aid gene annotation ...
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...