Labshake search
Citations for Illumina :
1 - 50 of 295 citations for Integrin beta 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... beta values from Illumina HumanMethylation27 (HM27 ...
-
bioRxiv - Physiology 2023Quote: Standard Argyrosomus regius gonadotropin subunit amino acidic sequences (alpha common, beta-FSH and beta-LH) were deduced from RNAseq (Illumina and Nanopore) analysis of mRNA extracted from meagre pituitaries ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... version 2.0.1.[48] Proportions of methylation values (Illumina “Beta” scale) were calculated ...
-
bioRxiv - Genomics 2021Quote: Beta values were generated from raw intensity signals using GenomeStudio software (Illumina) and exported into R 3.6 for data analysis ...
-
bioRxiv - Genomics 2019Quote: We downloaded DNA methylation data as beta values (platform Illumina Human Methylation 450) from GDC Data Portal (50 ...
-
bioRxiv - Bioengineering 2024Quote: ... To extract all DNA methylation beta values for the 102 nt BCAT1 promoter measured by Illumina EPIC array ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... Beta-values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). All samples were checked for duplicates by pairwise correlation of the genotyping probes on the 450k/EPIC array ...
-
bioRxiv - Cancer Biology 2020Quote: ... Beta-values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). All samples were checked for duplicates by pairwise correlation of the genotyping probes on the 450k/850k array ...
-
bioRxiv - Cancer Biology 2023Quote: ... We used the pan-cancer batch-corrected normalized gene expression and beta values for methylation from Illumina’s HumanMethylation450 BeadChip ...
-
bioRxiv - Cell Biology 2023Quote: ... beta values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). Out of 865,859 probes on the EPIC array ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Cancer Biology 2021Quote: ... Beta-values were calculated from the back-transformed intensities using an offset of 100 (as recommended by Illumina). Filtering of CpG probes was performed as described in Capper et al ...
-
bioRxiv - Genomics 2019Quote: ... we calculated Beta-normalized methylation levels based on the normalized intensity levels (according to the recommendation by Illumina).
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Molecular Biology 2020Quote: ... An additional QC measure to determine the concordance of average beta values generated for seven duplicate samples was completed using GenomeStudio (Illumina) v1.8 ...
-
bioRxiv - Cancer Biology 2022Quote: All 450K array methylation level files were downloaded (Data Type: “Methylation beta value”, Platform: “Illumina Human Methylation 450”; n = 507). The average CpG methylation level over DMRs identified in this study and GENCODE transcript promoters was calculated in all TCGA LUAD and matched normal samples ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resultant recombinants containing known donor barcodes and unknown recipient barcodes were sequenced by Illumina MiSeq platform ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Genomics 2019Quote: ... and Kraken 2.0.8-beta (54) were used to identify the best matching species for each 10x Chromium genomic DNA read (from Illumina HiSeq X and HiSeq4000 platforms). Our Kraken database contained 17 Old World monkey genomes and 19 Plasmodium genomes downloaded from NCBI FTP in June 2018 (52) ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Immunology 2024Quote: ... 3 biological replicates were sequenced with NextsSeq 550 (Illumina). For data analysis ...