Labshake search
Citations for Illumina :
1 - 50 of 567 citations for Integrin beta 1 binding protein 1 ITGB1BP1 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... beta values from Illumina HumanMethylation27 (HM27 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and g2997a) at the forward primer binding site used in the ‘round 1 PCR’ step below (the step attaching partial Illumina sequencing adaptors), thus excluding PCR amplification of the competitor viruses during sequencing library preparation such that only the library viruses ...
-
bioRxiv - Physiology 2023Quote: Standard Argyrosomus regius gonadotropin subunit amino acidic sequences (alpha common, beta-FSH and beta-LH) were deduced from RNAseq (Illumina and Nanopore) analysis of mRNA extracted from meagre pituitaries ...
-
bioRxiv - Genomics 2021Quote: ... reporter cDNA was PCR amplified using a reporter specific forward primer and a reverse primer binding the anchor sequence of the oligo- dT primer (corresponding to the Illumina TruSeq Read 1 sequence):
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... version 2.0.1.[48] Proportions of methylation values (Illumina “Beta” scale) were calculated ...
-
bioRxiv - Neuroscience 2024Quote: ... 3.5ug cDNA was biotin labeled (Nugen Illumina) 1.5ug of cDNA was hybridized to the Illumina Mouse WG-6 V2.0 BeadChip containing 45821 probes ...
-
bioRxiv - Genomics 2021Quote: Beta values were generated from raw intensity signals using GenomeStudio software (Illumina) and exported into R 3.6 for data analysis ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The biotin-labeled fragments were further enriched and sequenced by Illumina Novaseq ...
-
bioRxiv - Bioengineering 2024Quote: ... To extract all DNA methylation beta values for the 102 nt BCAT1 promoter measured by Illumina EPIC array ...
-
bioRxiv - Molecular Biology 2020Quote: ... The forward primer included a P5 sequence (for binding the Illumina flow cell) followed by a Illumina sequencing primer binding site ...
-
bioRxiv - Molecular Biology 2020Quote: ... the reverse primer included a P7 sequence (for binding the Illumina flow cell) followed by a 6-nt i7-index sequence ...
-
bioRxiv - Cancer Biology 2021Quote: ... Beta-values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). All samples were checked for duplicates by pairwise correlation of the genotyping probes on the 450k/EPIC array ...
-
bioRxiv - Cancer Biology 2020Quote: ... Beta-values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). All samples were checked for duplicates by pairwise correlation of the genotyping probes on the 450k/850k array ...
-
bioRxiv - Cancer Biology 2023Quote: ... We used the pan-cancer batch-corrected normalized gene expression and beta values for methylation from Illumina’s HumanMethylation450 BeadChip ...
-
bioRxiv - Cell Biology 2023Quote: ... beta values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). Out of 865,859 probes on the EPIC array ...
-
bioRxiv - Cancer Biology 2021Quote: ... Beta-values were calculated from the back-transformed intensities using an offset of 100 (as recommended by Illumina). Filtering of CpG probes was performed as described in Capper et al ...
-
bioRxiv - Genomics 2024Quote: ... The comparison of beta values with the existing genotype data (assessed using Global Screening Arrays [GSA+MD-24v3.0-Psych-24v1.1, Illumina, San Diego ...
-
bioRxiv - Cell Biology 2024Quote: ... were pooled at a 1:1:1:etc ratio before sequencing on an Illumina NextSeq 500/550 instrument using a version 2 kit (Illumina). Fastq files were generated for each library in Illumina BaseSpace ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% of PhiX (Illumina) was used as run control ...
-
bioRxiv - Bioengineering 2024Quote: CROP-Seq plasmid, Day6, and Day14 gRNA amplicon libraries (ALPHA, BETA, GAMMA) were sequenced on NovaSeq X Sequencer (Illumina). FATSQs files were analyzed using the MAGeCK python package for computing enrichment and depletion to the plasmid libraries at the gRNA and gene levels96 ...
-
bioRxiv - Genomics 2023Quote: ... All libraries were pooled and subjected to paired-end 75 bp sequencing (paired- end 76 nt reads with the first 1 nt of Read 1 and the last 1 nt of Read 2 trimmed) using the NextSeq500 system (Illumina, CA, USA). For each library ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of forward and 1 μl of reverse 25 μM PCR primers (Illumina), and 0.5 μl of Phusion high-fidelity DNA polymerase (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... collected with the magnet and resuspended in 24ul of Tagmentation Mix (1:1 Illumina 2× Tagmentation buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... An additional QC measure to determine the concordance of average beta values generated for seven duplicate samples was completed using GenomeStudio (Illumina) v1.8 ...
-
bioRxiv - Cancer Biology 2022Quote: All 450K array methylation level files were downloaded (Data Type: “Methylation beta value”, Platform: “Illumina Human Methylation 450”; n = 507). The average CpG methylation level over DMRs identified in this study and GENCODE transcript promoters was calculated in all TCGA LUAD and matched normal samples ...
-
bioRxiv - Immunology 2021Quote: ... Group 1 (The Netherlands, Illumina), Group 2 (France ...
-
bioRxiv - Microbiology 2021Quote: ... 1×75 cycles (Illumina, USA). Image analysis was performed in real time by the NextSeq Control Software and Real Time Analysis running on the instrument computer ...
-
bioRxiv - Systems Biology 2022Quote: ... 1% PhyX spike-in (Illumina) was added then pooled ...
-
bioRxiv - Immunology 2024Quote: ... 1 µL of TDE1 (Illumina), 0.25 µL of 5% digitonin (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... reverse-transcribed using random hexamer primers that introduce Truseq Small RNA kit RP1 primer binding sites (Illumina) and finally converted into DNA libraries using custom rpi primers (RNA PCR Primer Index ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 ng of PCR-1 product was used as template with TruSeq indexing primers (Illumina) and 10 cycles of PCR ...
-
bioRxiv - Genomics 2024Quote: ... Miniaturization involved testing libraries at 1/6th (IDT mini) or 1/8th (Roche mini, Illumina mini) of reaction volume tailoring input DNA to each kit between 24-45 ng total (Table 2) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μtagment DNA enzyme (Nextera, Illumina), l nuclease free water ...
-
bioRxiv - Immunology 2021Quote: ... 1 μl of transposase (Nextera, Illumina) was added and samples were incubated at 37°C for 10 minutes followed by two washes with low-salt buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... A 1% PhiX sequencing control (Illumina) was spiked in ...
-
bioRxiv - Immunology 2020Quote: ... cells were lysed in lysis buffer for 1 minute and transposed with Tagment DNA Enzyme 1 (Illumina) for 30 minutes ...
-
bioRxiv - Genetics 2020Quote: ... using a bead-to-DNA ratio of 1:1 before high-throughput sequencing on the MiniSeq system (Illumina). Libraries were sequenced 1 × 75bp for a minimum coverage of 2 million read depth ...
-
bioRxiv - Genomics 2022Quote: ... Consensus LADs (between the Nanopore-DamID undiluted and 1:1/10 dilution and between the two Illumina replicates) were determined using intersectBed.
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Genomics 2021Quote: ... 0.4 µM oligo 1 (a truncated Illumina read 1 sequence followed by six random bases ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Read 1 sequence (excluding Illumina barcodes) was aligned to a short reference sequence of AAV9:
-
bioRxiv - Synthetic Biology 2022Quote: ... The Read 1 sequence (excluding Illumina barcodes) was aligned to a short reference sequence of AAV9 ...
-
bioRxiv - Microbiology 2024Quote: ... spiked with 1% phage cDNA (PhiX, Illumina) and tested on the Illumina iSeq 100 before being sequenced on two NovaSeq S4 flow cells for deep sequencing.
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Genomics 2021Quote: ... at a 1:1 ratio and constructed into sequencing libraries using TruSeq DNA Preparation Kit (Illumina Inc, California, US). Sequencing was carried out using Illumina MiSeq paired-end 2 × 300 bp and performed by the High-Throughput Sequencing Core Facility in Biodiversity Research Center in Academia Sinica.
-
bioRxiv - Genomics 2024Quote: ... Two libraries were pooled and sequenced on a NextSeq 550 using High Output Kit v2.5 (300 Cycles: 146 read 1, 18 index 1, 8 index 2, 146 read 2) (Illumina) according to the manufacturers protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCT TG, Illumina TruSeq Adapter Read 2 ...
-
bioRxiv - Microbiology 2021Quote: ... The purified PCR products were then processed and sequenced using the NextSeq 75 – High Output (82 cycles in read 1, 8 cycles in index 1, and 8 cycles in index 2 SE reads) (Illumina). The sequencing data was analyzed using the Model-Based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK ...