Labshake search
Citations for Illumina :
451 - 500 of 973 citations for IL 2RA Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Nuclei were re-suspended in transposase reaction mix (25 μL 2×TD buffer, 2.5 μL transposase (FC-121-1030, Illumina) and 22.5 μL nuclease-free water ...
-
bioRxiv - Systems Biology 2019Quote: ... Libraries were loaded with a concentration of 2.2pM on 75 cycle high output flow cells (Illumina, FC-404-2005) and sequenced on a NextSeq 500 (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... MS-103-2003) at a concentration of 15 nM with addition 25% Phix Control v3 (Illumina, FC-11-2003). The MiSeq separated all sequences by sample during post-run processing by recognised indices and to generate FASTQ files.
-
bioRxiv - Genomics 2019Quote: ... Then perform tagmentation using 2 μl of Tn5 transposase and 12.5 ul 2 × TD buffer (Illumina #FC-121-1031) at 37°C for 1h with 650 rpm shaking ...
-
bioRxiv - Genomics 2019Quote: ATAC-seq was carried out as previously described using the Nextera DNA Library Prep Kit (Illumina #FC-121-1030)60 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... MS-103-2003) at a concentration of 15 nM with addition 25% Phix Control v3 (Illumina, FC-11-2003).
-
bioRxiv - Microbiology 2019Quote: ... Viral DNA libraries were generated by Nextera XT DNA Library Preparation Kit (Cat. No. FC-131-1096, Illumina, USA) by a slightly modified manufactures protocol divided into” Genomic DNA tagmentation” and “PCR clean-up” ...
-
bioRxiv - Neuroscience 2020Quote: ... and sequenced on an Illumina HiSeq 2500 using HiSeq SBS kit v4 250 cycle kit (Illumina, FC-401-4003). A standard Illumina pipeline was used to generate fastq files ...
-
bioRxiv - Physiology 2021Quote: ... Libraries were prepared from ∼150 pg of DNA using the Nextera XT DNA preparation kit (Illumina, FC-131-1096) and Nextera XT 96-Index kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were loaded with a concentration of 2.2pM on 75 cycle high output flow cells (Illumina, FC-404-2005) and sequenced on a NextSeq 500/550 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... and metagenomic DNA sequencing libraries were constructed using the Nextera XT DNA Library Prep Kit (FC-131-1096, Illumina) and sequenced on a NextSeq500 Sequencing System as 2 x 150 nucleotide paired-end reads ...
-
bioRxiv - Neuroscience 2019Quote: ... we tagmented 600 pg of DNA using the Nextera XT DNA Sample Preparation Kit (Illumina, cat # FC-131-1096). Libraries were further amplified with 12 PCR cycles using custom P5-TSO hybrid and custom Nextera-compatible primers with different indexes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5μL Tn5 transposase and 22.5μL ddH2O) using reagents from the Nextera DNA library Preparation Kit (Illumina #FC-121-103). Samples were then incubated at 37°C for 30min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nuclei pellets were resuspended gently in transposition reaction mix (25 µL 2X TD Buffer [Illumina Cat #FC-121-1030], 2.5 µL transposase [Illumina Cat #FC-121-1030] and 22.5 µL nuclease-free water ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled libraries were sequenced using the NextSeq 500/550 High Output v2 kit (75 cycles, Illumina, FC-404-2005) with single reads on a NextSeq500 (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... nuclei were extracted from cells and treated with transposition mixture containing Nextera Tn5 Transposase for (Illumina, FC-121-1030). Transposed fragments were then purified using QIAGEN MinElute columns (QIAGEN ...
-
bioRxiv - Microbiology 2021Quote: ... and libraries were prepared with a Nextera XT DNA kit (catalog number FC-131-1096; Illumina, San Diego, CA). Normalization ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequencing was followed previously reported protocols.67,68 The sequencing library was constructed by using the Nextera XT tagmentation kit (Cat# FC-131-1096, Illumina), and the HiSeq2500 instrument (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... Library construction was performed using the Nextera XT Library Prep kit (#FC-131-1024, Illumina, San Diego, California, USA) and custom barcode adapters (sequences available upon request) ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries were constructed with the Nextera XT DNA Library Prep Kit (FC-131-1096, Illumina, San Diego, California, USA). All reads were finished using CLC Genomics Workbench v ...
-
bioRxiv - Genetics 2019Quote: Sequencing libraries were prepared using the truseq Nano DNA sample preparation kit (T FC-121-4001/4002, Illumina Inc) extracting 100 ng DNA for each sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... 120 μl pooled 20 pM library and 15 μl denatured 20 pM PhiX control library (Illumina, FC-110-3001) after a 2 minute heat treatment at 96 °C followed by a 5 min incubation on ice ...
-
bioRxiv - Genomics 2021Quote: ... Each sample library was uniquely barcoded and quantified by qPCR using a PhiX Control v3 (Illumina, FC-110-3001) standard curve ...
-
bioRxiv - Genomics 2019Quote: ... and sequenced on an Illumina NextSeq 500 instrument with a High Output v2 reagent kit (Illumina #FC-404-2005), reading 86 nt for read 1 and 6 nt for the P7 index read ...
-
bioRxiv - Genetics 2019Quote: ... All sequencing followed the protocol in the Illumina TruSeq PCR-Free Sample Preparation Guide (Illumina cat# FC-121-2001), and used PCR-free library preparation kits purchased from KAPA Biosystems (see https://www.nhlbiwgs.org/topmed-whole-genome-sequencing-project-freeze-5b-phases-1-and-2 for additional details) ...
-
bioRxiv - Physiology 2020Quote: ... which was processed into the sequencing library using the Nextera XT DNA Library Preparation Kit (FC-131-1096, Illumina) with unique barcode sequences for each set ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transposed fragments were amplified and purified as described previously (Buenrostro 2015) with Nextera Index Kit (FC-121-1011, Illumina). qPCR was performed to determine the optimal number of cycles to amplify the library to reduce artifacts associated with saturation PCR of complex libraries ...
-
bioRxiv - Genomics 2021Quote: Sequencing libraries were generated using the sequencing kit: TruSeq SBS Kit v5 – GA (36 Cycle) (FC- 104-5001, Illumina). Samples were then sequenced on an Illumina GA-IIx sequencer using paired-end (PE ...
-
bioRxiv - Genomics 2021Quote: ... and tagmented using the enzyme and buffer provided in the Nextera Library Prep Kit (Illumina, cat. FC-121-1031). Tagmented DNA was then purified using the MinElute PCR purification kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR-free libraries were prepared from 1μg DNA using the TruSeq PCRfree DNA sample preparation kit (cat# FC-121-3001/3002, Illumina) targeting an insert size of 350bp ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.5 µl of Tagment DNA buffer 1.25 µl of Amplicon Tagment Mix (Nextera XT kit, Illumina FC-131-1096) were added ...
-
bioRxiv - Genomics 2022Quote: ... 600 pg cDNA from each sample plate was used in a modified Nextera XT (Illumina, Cat. FC-131-1024) library preparation but using the P5NEXTPT5 primer and the tagmentation time of 5 mins ...
-
bioRxiv - Genetics 2022Quote: ... Normalised DNA libraries were clustered on Illumina cBot then sequenced using Illumina HiSeq X Ten platform using HiSeq X Ten Reagent Kit v2.5 kits (FC-501-2501, Illumina). Paired end sequencing was performed using the 2×150bp chemistry to achieve an average output of approximately >120 Gb of data per library.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted to 0.2 ng/ul in TE and tagmented (Nextera XT DNA Library Preparation Kit (#FC-131-1096, Illumina). Indexing was performed using the Nextera XT Index Kit (#FC-131-1001 ...
-
bioRxiv - Cell Biology 2022Quote: ... 10μl of the tagmented chromatin was mixed with 2.5μl of Nextera PCR primer cocktail and 7.5μl of Nextera PCR master-mix (Illumina FC-121-1030) in low-binding PCR tubes ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were pooled in equimolar concentrations and sequenced using an Illumina NextSeq 500/550 sequencer (Illumina, FC-404-2005). At least 95% of the reads generated presented a Q score of ≥ 30 ...
-
bioRxiv - Microbiology 2024Quote: ... This PCR product was prepared for sequencing using the Nextera XT DNA Sample Prep Kit (Illumina, FC-131-1096) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Two arrays were sequenced per sequencing run with an Illumina 75 Cycle NextSeq500/550v2 kit (Illumina FC-404–2005) at a final concentration of 2.4 pM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were added with 50mL trans-position reaction mix of Nextera DNA library preparation kit (FC-121-1031, Illumina). DNA was amplified by PCR and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Tagmentation and indexed library amplification were done with Nextera® XT DNA Library Preparation Kit (Illumina, FC-131-1096) and Nextera® XT Index Kit (96 indexes ...
-
bioRxiv - Genetics 2020Quote: ... MS-103-2003) at a concentration of 15 nM with addition of 15% Phix control v3 (Illumina, FC-11-2003). The Illumina Mi-Seq post-run processing uses the barcoded indices to split all sequences by sample and generate FASTQ files ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then indexed using forward (i7) and reverse (i5) index primers from the Nextera Index Kit (Illumina FC-121-1011). Index ligation and fragment amplification were achieved using the method’s PCR amplification thermal cycling program.
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mono-nucleosomal DNAs were subjected to sequencing using a TruSeq DNA library prep kit (FC-121-2001, Illumina). The final libraries were sequenced using an Illumina HiSeq 2500 platform ...
-
bioRxiv - Molecular Biology 2021Quote: ... Tagmentation of 600pg of cDNA is performed according to Nextera DNA sample preparation manufacturer instructions (Illumina, Inc., FC-131-1096) using a Truseq-P5 hybrid constant oligo (IDT ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Developmental Biology 2019Quote: ... quantification and Nextera library construction were done following the published ChIPmentation protocol (Schmidl et al., 2015) using indexed Illumina adapters (FC-121-1011, Illumina). Illumina adaptors were removed from the ChIP and ChIPmentation reads using Cutadapt (1.6 ...
-
bioRxiv - Systems Biology 2020Quote: cDNA was tagmented and amplified using the Nextera XT DNA Library Preparation Kit (FC-131-1096, Illumina, San Diego, CA). The manufacturer’s protocol was followed with the following modified reagent volumes and primers ...
-
bioRxiv - Immunology 2019Quote: ... and by enzymatic fragmentation of 300 pg of cDNA followed by 12 PCR cycles using the Nextera XT DNA Library Preparation Kit (cat# FC-131-1096, Illumina). Sequencing of the 15 mRNAseq libraries multiplexed together was carried out with an Illumina HiSeq2500 on a 2x125 bp paired-end run.
-
bioRxiv - Genomics 2019Quote: ... Each sample library was uniquely barcoded and quantified by PCR using a PhiX Control v3 (Illumina, Cat #FC-110-3001) standard curve ...
-
bioRxiv - Genetics 2020Quote: ... MS-103-2003) at a concentration of 15nM with the addition of 15% Phix Control v3 (Illumina, FC-11-2003) previously described by Shaukat et al ...