Labshake search
Citations for Illumina :
101 - 150 of 152 citations for Hyaluronidase PH 20 SPAM1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... The final libraries were then pooled together (15-20 at a time) and sequenced using the NextSeq 500/550 kit High Output Kit v2.5 (Illumina 20024906). The Illumina output files were converted to fastq format using bcl2fastq (v2.20.0.422 ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation of genomic DNA was done using the LITE pipeline as described previously (20) and sequencing was performed using Nextseq (Illumina) with a Mid Output Flowcell (NSQ® 500 Mid Output KT v2) ...
-
bioRxiv - Genetics 2022Quote: ... PCR products from each locus were pooled to equimolarity at 20 ng/µl and submitted to GeneWiz (Azenta Life Sciences) for sequencing (Amplicon-EZ: Illumina MiSeq ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were sequenced to a depth of 20 million paired-end 2×150bp reads each on the NovaSeq 6000 (Illumina) at University of Colorado Genomics and Microarray Core.
-
bioRxiv - Cell Biology 2022Quote: Sequencing libraries were prepared by polyA selection for mRNA and sequenced to a depth of 20-30 Mio reads (HiSeq 4000 2 × 150 paired-end configuration, Illumina). Sequence reads were trimmed to remove possible adapter sequences and nucleotides with poor quality using Trimmomatic v.0.36 ...
-
bioRxiv - Cancer Biology 2023Quote: ... nuclei pelleted in ATAC-wash-resuspension buffer and resuspended in transposition mix (2X TD buffer, 1X PBS, Digitonin 0.01%, tween 20 0.1%, NFW 5ul, and Illumina transposase 2.5ul). Libraries were PCR-amplified using the NEBNext Hi-Fidelity PCR Master Mix and Integrated DNA Technologies (IDT ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... Paired-end (150-bp) sequencing of each library (approx. 20 million reads per library) was then performed on the NextSeq 550 platform (Illumina). All library preparation and sequencing procedures were carried out by the Analytical Facility at QIMRB.
-
bioRxiv - Systems Biology 2023Quote: ... the final library was diluted to 20 nM with HT1 buffer and PhiX control v3 (20%, v/v) and 600 µL was loaded onto a MiSeq v2 (500 cycles) reagent cartridge (Illumina). The resulting sequences were uploaded to Illumina Sequence Hub and downloaded using BaseSpace Sequence Hub Downloader (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... CUT&RUN libraries (10–20 Mio reads per sample and 1/3 of reads for the controls) were sequenced on a NovaSeq 6000 (Illumina) paired end 100 bp at the Deep Sequencing Facility (Max Planck Institute for Immunobiology and Epigenetics ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: Eluted PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) ...
-
bioRxiv - Genetics 2021Quote: ... The permeabilized myonuclei were tagmented with tagmentation mixture optimized for use on a myofiber (20 µL Tagment DNA Buffer (TD Buffer) (Illumina, 20034197), 13.3 µL PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sample libraries (20 nM) were subjected to multiplex next generation sequencing using an Illumina HiSeq4000 (Illumina Inc.; San Diego, CA, USA). Quality control on raw reads was performed using FASTQC ...
-
bioRxiv - Microbiology 2019Quote: ... containing 20% phiX DNA was denatured and sequenced (2 × 250 nt) on an Illumina MiSeq instrument (Illumina Inc, San Diego, CA) using a v2 500 cycle kit ...
-
bioRxiv - Microbiology 2020Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Neuroscience 2021Quote: ... libraries were pooled using a final concentration of 20 pM and subjected to paired-end sequencing using Illumina HiSeq 2500 (Illumina, USA) platform and HiSeq Paired-End Cluster Kits v4.
-
bioRxiv - Genomics 2022Quote: ... pH 7.4, 5 mM MgCl2, 10% dimethyl formamide, 0.33x PBS, 0.01% digitonin, 0.1% Tween-20, 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The resulting cRNA samples were hybridized to an Illumina Human WG6 Expression BeadChip array for 14-20 hour at 58°C in an Illumina Hybridization Oven (Illumina Inc.). Arrays were washed and scanned following the protocols in the Illumina Whole-Genome Gene Expression Direct Hybridization Assay Guide (Illumina) ...
-
bioRxiv - Neuroscience 2024Quote: ... We sequenced pooled final libraries targeting 20 million reads per sample on the NovaSeq 6000 S4 flowcell (Illumina, San Diego, CA).
-
bioRxiv - Biochemistry 2024Quote: ... a T7 promoter-containing oligonucleotide was annealed to an equimolar quantity of RBNS T7 template oligonucleotide (a random 20-mer flanked by partial Illumina adapters). 500 fmol template were transcribed overnight at 37°C with 200 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2024Quote: As template a T7 promoter-containing oligonucleotide was annealed to an equimolar quantity of RBNS T7 template oligonucleotide (a random 20-mer flanked by partial Illumina primers). 500 fmol template were transcribed overnight at 37°C with 200 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Reads were trimmed to remove adapter sequences and low-quality regions (Q < 30 and Q < 20 for Illumina and 454 data, respectively) were removed using Cutadapt 1.4.1 (Martin 2011 ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 ul H2O) at 37◻°C for 30◻min (TruePrep® DNA Library Prep Kit V2 for Illumina, Vazyme, China). After the tagmentation ...
-
bioRxiv - Immunology 2020Quote: ... then sequenced to a depth of at least 20 M single-end 75 bp reads using NextSeq 500 (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2020Quote: ... using 5% PhiX without dark cycles (n = 11) or 10-20% PhiX with 7 dark cycles (protocol provided by Illumina, n = 49). A maximum of 12 samples were pooled in one sequencing run resulting in 19.05 million [17.05 – 21.72] single-end reads per sample on average (supplementary table 3).
-
bioRxiv - Molecular Biology 2023Quote: Trimmomatic version 0.39 was employed to trim reads after a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides (Bolger et al., Trimmomatic: a flexible trimmer for Illumina sequence data). Reads were aligned versus Ensembl human genome version hg38 (Ensembl release 104 ...
-
bioRxiv - Cell Biology 2023Quote: RNA libraries were prepared using 200 ng of total RNA in 20 µl according to the manufacturer’s instructions for the Illumina Stranded mRNA Ligation Sample Prep Kit (Illumina, San Diego, CA). The concentration and size distribution of the completed libraries were determined using an Agilent Bioanalyzer DNA 1000 chip and Qubit fluorometry (Invitrogen) ...
-
bioRxiv - Genetics 2023Quote: ... We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles, Tm 65 °C). We then performed a bead cleanup ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA from approximately 15-20 progeny per mutant were pooled and sequencing libraries were prepared with a Nextera kit (Illumina, FC-121-1030). All whole genome sequencing data is available on NCBI SRA (accession #PRJNA526508) ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR products of each sample were mixed to a final concentration of 20 pmol and then sequenced with a MiSeq benchtop sequencer (Illumina, San Diego, USA) for 2×300 bp paired-ends sequencing.
-
bioRxiv - Genetics 2021Quote: ... homokaryotic mutants were crossed to a genetically polymorphic Mauriceville strain and approximately 15-20 antibiotic-resistant progeny were pooled and prepared for whole genome sequencing using the Nextera kit (Illumina, FC-121-1030). Mapping of the critical mutations was performed as previously described (Hunter 2007 ...
-
bioRxiv - Neuroscience 2020Quote: ... 50bp RNA-seq of IP fractions and total homogenate from 5 replicates per cell type (20 samples total) was performed on a single lane of a HiSeq 3000 (Illumina, San Diego, California), yielding ∼350M reads ...
-
bioRxiv - Genetics 2020Quote: ... one unit of input was diluted to 30 μl and mixed with 50 μl of 2x TD buffer and 20 μl of TDE (Illumina 20034197, Lot 20436911), and incubated at 55 °C for 10 min (Note ...
-
bioRxiv - Genomics 2019Quote: ... and 800 bp) and four mate-pair libraries (2, 6, 10, and 20 Kb) following the standard protocols provided by Illumina (San Diego, USA). Subsequently ...
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5’ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3’ ...
-
bioRxiv - Immunology 2022Quote: ... and pooled to form an equimolar sequencing library that was denatured and diluted to 1.2 pM with a 20% PhiX v3 control library (Illumina, Cat#FC-110-3001), as described in the Illumina Denature and Dilution protocol (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... spun at 300G for 12 min at 4 ºC and resuspended in 20 uL transposition mix: 1X TD buffer and 2 uL of TDE1 (Illumina #FC-121-1030), 0.01% Digitonin in DMSO ...
-
bioRxiv - Cancer Biology 2023Quote: ... of libraries were pooled and subjected to sequencing of approximately 20 million reads per sample using the Mid Output v2 kit (Illumina, FC-404-2001) on a Illumina NextSeq550 following the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... about 1.5 ng purified pre-amplified cDNA sample was fragmented in four 20 μl tagmentation mix (10 μl 2x TD buffer, 5 μl Nextera XT (Illumina, FC-131-1096), and 5 μl cDNA sample ...
-
bioRxiv - Microbiology 2023Quote: ... The diluted library was combined with the subsequent PhiX control v3 (20%, v/v) and loaded onto a MiSeq v2 (500 cycles) reagent cartridge (Illumina, Carlsbad, CA, USA). The resulting sequences were uploaded to BaseSpace (Illumina ...
-
bioRxiv - Systems Biology 2023Quote: ChIP-seq and input libraries were sequenced on the Illumina NextSeq 500 system with a ∼20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Microbiology 2023Quote: ... The pooled library (600 μL at 20 picomolar) was denatured and sequenced on an Illumina MiSeq sequencer (Illumina Inc., San Diego, CA, US).
-
bioRxiv - Plant Biology 2021Quote: ... A total of 20 RNA-Seq libraries (one per individual) were prepared with the TruSeq RNA Library Preparation Kit v2 (Illumina, San Diego, CA, USA) using 0.5 μg of starting RNA and aiming at a median insert size of ∼ 155 bp (standard fragmentation protocol) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sequencing was done using the Illumina NextSeq500 to obtain >20 million 75bp single-end or 37bp paired-end reads per sample or at Genewiz (HiSeq, 150bp, paired end) (Illumina, South Plainfield, NJ, USA).
-
bioRxiv - Immunology 2023Quote: ... 3mM MgCl2) on ice and resuspended in 10μl of transposition mix (1X TD Buffer from Illumina, Transposase from Illumina, 0,01% digitonin, 0,1% Tween-20). Tagmentation was performed on a thermomixer at 1000rpm 37°C during 30min ...
-
bioRxiv - Immunology 2023Quote: ... The library was then denatured and diluted to 1.2 pM according to standard Illumina’s protocols (for 4 nM libraries) and was spiked with 22% of 20 pM PhiX control (Illumina, cat. no: FC-110-3001). The 1.2 pM library was sequenced on the NextSeq using the NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Zoology 2023Quote: ... were used for kinship analysis and pedigree mapping.17,18 Files were generated using high coverage (20-30X) whole genome short read (150bp) sequencing data generated using the sequence by synthesis approach (Illumina inc., San Diego, CA) and aligned to the NCBI35 (hg17 ...
-
bioRxiv - Developmental Biology 2022Quote: Raw reads were subjected to adapter and quality trimming with cutadapt (version 2.4; parameters: --quality-cutoff 20 --overlap 5 --minimum-length 25; Illumina TruSeq adapter clipped from both reads) followed by trimming of 10 nucleotides from the 5’ and 3’ end of both reads ...
-
bioRxiv - Plant Biology 2021Quote: ... and pooled libraries of 20 barcoded samples were sent for pair-end sequencing using an Illumina HiSeqTM 2500 sequencing platform (Illumina Inc., San Diego, CA, USA).
-
bioRxiv - Immunology 2021Quote: Single-cell antibody repertoire libraries were sequenced on an Illumina NovaSeq 6000 system (Illumina RTA Version: V3.4.4) using a 26 x 91 bp read configuration.