Labshake search
Citations for Illumina :
151 - 200 of 888 citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The 5μg total RNA (DNase-treated) was outsourced for the RNA-Seq on Hi-Seq 2000 genome analyzer (Illumina) sequencing platform ...
-
bioRxiv - Genomics 2023Quote: ... about 40 ng purified pre-amplified Hi-C sample was fragmented in two 50 μl tagmentation mix (1x TD buffer and 0.5 μl TDE1 (Illumina Tagment DNA TDE1 Enzyme and Buffer Kit ...
-
bioRxiv - Genomics 2023Quote: ... and sequenced by PacBio Sequel II. Hi-C libraries were prepared following a standard protocol (Belton et al. 2012) and sequenced by Illumina HiSeq 4000 (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: ... Antibody tag libraries were sequenced with an Illumina NextSeq 550 75-cycle High Output Kit (Illumina, cat. no. 20024906) in paired-end mode ...
-
bioRxiv - Microbiology 2023Quote: Raw FASTQ files provided by the GTF containing all reads and corresponding tags indicating whether they were accepted or filtered out according to the CASAVA 1.82 pipeline (Illumina). Only reads tagged as accepted were kept for further analysis ...
-
bioRxiv - Developmental Biology 2023Quote: 6hpf and 12hpf H2A.Z and Anp32e genomic localization data were collected using Epicypher CUT&Tag protocol and library generation followed by Illumina paired-end sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: DNA methylation data (Illumina human methylation 450k BeadChip) and clinical information of 8,118 patients across 24 tissue types were obtained from in GDC data portal [29] using TCGAbiolink (Bioconductor package ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: The Infinium Human Methylation EPIC BeadChip (Illumina, USA) array was performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Methylation data (Illumina Human Methylation 450 platform) for TCGA cohorts were downloaded from the Firebrowse website hosed by Broad Institute of MIT and Harvard ...
-
bioRxiv - Molecular Biology 2021Quote: ... Paired-end Illumina sequencing libraries were prepared and total RNA-seq was performed with the Hi-seq 2500 (Illumina Inc.).
-
bioRxiv - Genomics 2019Quote: The statistical package edgeR (Version 3.7) within the R software suite (Version 3.1) was used to analyse the RNA-seq (Illumina Hi-Seq) data and to identify transcripts significantly differentially expressed between P ...
-
bioRxiv - Microbiology 2020Quote: A NextSeq run was completed on the pooled libraries using the NextSeq 500 hi-output v2 75-cycle kit and Buffer Cartridge (Illumina). Sequence files were downloaded from the MIP NGS server ...
-
bioRxiv - Microbiology 2021Quote: ... A NextSeq run was completed on the pooled libraries using the NextSeq 500 hi-output v2 75-cycle kit and Buffer Cartridge (Illumina). Sequence files were downloaded from the NGS server ...
-
bioRxiv - Plant Biology 2021Quote: ... Libraries were constructed using the Nextera DNA preparation kit and sequenced on an Illumina Hi-Seq 2500 platform (paired-end 125 bp reads) (Illumina). Quality control reports for the raw sequencing reads were generated using FastQC (Andrews ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries for all samples were sequenced as 150 bp paired-end reads on a single lane of Illumina Hi-Seq 4000 (Illumina). Reads were bioinformatically de-multiplexed ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled sequencing libraries were loaded at a concentration of 1.8pM with 10% PhiX spike-in and sequenced using eight Illumina NextSeq 150 Cycle Hi-Output v2.5 kits (Illumina #20024907) on an Illumina NextSeq 550 System ...
-
bioRxiv - Neuroscience 2021Quote: Sequencing of the pooled libraries was completed by the NIDDK Genomics Core on an Illumina NextSeq 550 system using a NextSeq 150 Cycle Hi-Output v2.5 kit (Illumina #20024907), generating a total of 400 million reads for an estimated sequencing depth of 40,000 reads per cell ...
-
bioRxiv - Genomics 2019Quote: ... Two 3rd instar larvae were selected for Hi-C library construction and then sequenced on a HiSeq 2500 platform (Illumina). In addition ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Hi-C libraries were processed to paired-end sequencing on the Illumina Hiseq 4000 (Illumina, San Diego, CA, USA) platform with read length of 150 bp.
-
bioRxiv - Genetics 2022Quote: ... Variants considered causative were validated in the proband and studied in his parents by deep amplicon sequencing performed using Nextera XT Kit (Illumina) and paired-end sequencing as described above for WES.
-
bioRxiv - Genetics 2023Quote: ... Samples were indexed and pairs for each experiment were pooled for sequencing using the NextSeq 500/550 Hi Output KT v2.5 (Illumina #20024907) on an Illumina NextSeq550 ...
-
bioRxiv - Genomics 2024Quote: The chromatin conformation capture (Hi-C) fragment libraries were constructed from 300-700 bp insert size and were measured by Illumina platform for auxiliary assembly (Rao et al. ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Genomics 2019Quote: ... and Kraken 2.0.8-beta (54) were used to identify the best matching species for each 10x Chromium genomic DNA read (from Illumina HiSeq X and HiSeq4000 platforms). Our Kraken database contained 17 Old World monkey genomes and 19 Plasmodium genomes downloaded from NCBI FTP in June 2018 (52) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the samples were subjected to library RT and amplification to tag the RNA molecules with specific and unique sample indexes (Illumina), followed by a final beads cleanup (1:0.8 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the samples were subjected to library RT and amplification to tag the RNA molecules with specific and unique sample indexes (Illumina), followed by a final beads cleanup (1:0.8 ...
-
bioRxiv - Cell Biology 2023Quote: ... after which the samples were subjected to library reverse transcriptase and amplification to tag the RNA molecules with specific and unique sample indexes (Illumina), followed by a final beads cleanup (1:0.8 ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Genomics 2020Quote: ... Human libraries were sequenced on a NovaSeq 6000 (Illumina) and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA expression log intensity levels (Illumina Human v3 microarray) were used as the expression levels of the genes ...
-
bioRxiv - Developmental Biology 2019Quote: ... Four nM samples were pooled and run on a NextSeq 500/550 Hi Output Kit (20024907, Illumina, Inc. San Diego, CA) and the NextSeq 500 Illumina Sequencer to obtain paired end reads of 75bp ...
-
bioRxiv - Plant Biology 2021Quote: ... The chimeric fragments were isolated and then constructed to five Hi-C libraries that were sequenced on an Illumina NovaSeq platform (Illumina, USA) with 2×150 bp pair-end reads ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...