Labshake search
Citations for Illumina :
301 - 350 of 8968 citations for Human Urocortin 3 UCN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... in adolescents and Illumina Human-6 Expression Bead Chips (Illumina, Inc. San Diego, CA) in adults ...
-
bioRxiv - Systems Biology 2022Quote: ... Human DNA samples for the COVID study were subjected to the Infinium MethylationEPIC array (Illumina) at AKESOgen Inc. ...
-
bioRxiv - Genetics 2021Quote: ... we genotyped the genomic DNA with the OmniChip from the Human OmniExpressExome-8v1.2 from Illumina Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA samples were analyzed using Human HT expression BeadChip V4 (Illumina, San Diego, CA, USA). Raw data were processed using the bead array package from Bioconductor (16) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genome-wide DNA methylation patterns were evaluated by Infinium Human Methylation 850 K BeadChips (Illumina), which determine the methylation levels of 853,307 CpG sites ...
-
bioRxiv - Biophysics 2023Quote: ... we aligned the trimmed reads to the human reference genome (hg19, downloaded from Illumina’s iGenomes) using Hisat2 94 with “-k 1 –no-spliced-alignment –phred33” parameters and stored them as binary alignment maps (BAM) ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...
-
bioRxiv - Genomics 2021Quote: ... Lab 3 sequenced DNA on a NextSeq 550 (Illumina, San Diego, CA, USA), paired-end 2×75 bp ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Genomics 2019Quote: ... and hybridized the samples to the Illumina Human Methylation 450K BeadChip array (Illumina, San Diego, CA), according to the manufacturers’ recommended protocols ...
-
bioRxiv - Bioengineering 2022Quote: ... Hybridization of 750ng of cRNA on Human HT-12 v4.0 Expression BeadChip (Illumina, BD-103-0604), were performed according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... Cohort 2 gene expression data were measured using a Human Ref-8 BeadChip array (Illumina, Inc) with ∼22k probes ...
-
bioRxiv - Developmental Biology 2022Quote: Since the human epidemiological cohort data were generated on a different genomic platform (Illumina 450K array), we developed an imputation scheme for converting measurements between the two platforms ...
-
bioRxiv - Immunology 2019Quote: ... Hybridization of the cRNA was performed on an Illumina Human-HT12 Version 4 chip set (Illumina). Microrarray data were exported from GenomeStudio (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... The sample was genotyped on the Illumina Human Core Exome Array (Illumina, San Diego, CA, US). GWAS QC was performed using standard methods and imputation was done using the HRC panel [63] on the Sanger Imputation server (https://imputation.sanger.ac.uk/) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DNA methylation was quantified using Infinium® Human Methylation 450K BeadChip (Illumina Inc.; San Diego, CA).
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA sequencing was performed at BCM Human Genome Sequencing Center using NovaSeq 6000 platform (Illumina). The raw fastq files were first quality checked using FastQC v0.11.8 software (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/) ...
-
bioRxiv - Genomics 2024Quote: ... combined with methylation data collected from the public TCGA LUAD study (Illumina Human Methylation 450k BeadChip) (Supplementary Table 1) ...
-
bioRxiv - Bioengineering 2024Quote: The compressed paired-end human mRNA-seq data in fastq format over 80 gigabytes from Illumina PE150 ...
-
bioRxiv - Molecular Biology 2024Quote: ... we used the 318 curated files containing raw human blood expression data (FASTQ containing Illumina reads) of the Bgee project (see supplementary data of (Bastian et al ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2020Quote: ... TruSeq SBS Kit v3-HS 50 cycles kit (Illumina).
-
bioRxiv - Genomics 2020Quote: ... microRNA expression profiling was performed using the human v2.0 microRNA Expression BeadChip (Illumina, Inc., San Diego, Calif) with 1146 microRNAs covering 97% of the miRBase 12.0 database according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2019Quote: ... mRNA expression levels were extracted from microarray analyses performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nextera XT Index Kit and Miseq Sequencing Kit (MiSeq Reagent Kits v2,300 cylce) were purchased from Illumina.
-
bioRxiv - Genomics 2022Quote: ... Tagmentation Kit (Illumina) following the Illumina reference guide instructions and recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Ligation kit (Illumina). One ug of RNA was processed for each sample ...
-
bioRxiv - Genomics 2022Quote: ... kit (Illumina #20025523) by the University of Michigan Advanced Genomics Core ...
-
bioRxiv - Genetics 2023Quote: ... Ligation kit (Illumina), followed by 100 bp single-end sequencing on an Illumina NovaSeq 6000 SP system.
-
bioRxiv - Cell Biology 2022Quote: ... Ligation Kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... and iPSC-derived neural progenitor cells (NPC-FGF) was assessed using the Infinium Human Methylation EPIC BeadChip (Illumina), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples that met the Illumina TruSeq Stranded Total RNA (Human/Mouse/Rat) (Illumina Inc., San Diego, CA,USA) sample input guidelines were prepared according to the kits protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reads were confirmed to be post-quality control by Prinseq and mapped to the human donor sequence (hCoV-19/Germany/BavPat1/2020|EPI_ISL_406862|2020-01-28) using BWA (Illumina) and Pomoxis mini_align (Minion) ...
-
bioRxiv - Neuroscience 2019Quote: ... 332 cells from eight adult human brains (three males and five females) were collected and profiled by Illumina MiSeq and Illumina NextSeq 500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNAseq-based gene expression and methylation array data (either Illumina human methylation27K array, n = 15 genomes; or Illumina human methylation450K array ...
-
bioRxiv - Genomics 2022Quote: ... the samples were applied following the Illumina Infinium Human Methylation DNA chip manufacturer protocols (Illumina, San Diego, CA). Chips were analyzed using the Illumina Hi-Scan system at the McDonnell Genome Institute (MGI ...
-
bioRxiv - Microbiology 2022Quote: ... Raw sequencing reads were aligned to the hg19 human genome with the Basespace RNA-Seq Aligment application (Illumina). GO-term enrichment was performed using Biojupies (44) ...
-
bioRxiv - Cell Biology 2022Quote: We identified genes with significantly differential transcript levels following the RSEM-EBSeq workflow outlined at http://deweylab.github.io/RSEM and used the sequences and annotation of UCSC human genome v19 (hg19) from Illumina igenome ...
-
bioRxiv - Neuroscience 2022Quote: ... Pair-end reads of cDNA sequences were aligned back to the human genome (UCSC hg19 from Illumina iGenome) by the spliced read mapper TopHat (v2.0.4 ...