Labshake search
Citations for Illumina :
1 - 50 of 1461 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... The second PCR primer pair (Illumina_seqPCR) was used to attach Illumina adaptors and to barcode samples ...
-
bioRxiv - Genetics 2020Quote: ... and amplified with the inner primer pair (Illumina P5 + bait-specific P7 index-attached reverse primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... QHR-4C libraries were constructed with specific primer pairs (forward primers containing Illumina P5 with sequences near a specific viewpoint and reverse primers containing Illumina P7 with an index and sequences matching the adapter ...
-
bioRxiv - Microbiology 2023Quote: ... Unique Dual Index Primer pairs (NEBNext Multiplex Oligos for Illumina) were used to index the samples ...
-
bioRxiv - Molecular Biology 2023Quote: We designed two primer pools of 106 primer pairs with DesignStudio (Illumina, San Diego, CA, USA) to amplify PKD1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... QHR-4C libraries were constructed with specific primer pairs (forward primers containing Illumina P5 with sequences near a specific viewpoint and reverse primers containing Illumina P7 with an index and sequences matching the adapter ...
-
bioRxiv - Genomics 2023Quote: ... Primers were unique pairs of index primers (i5 and i7) from the Nextera XT DNA library preparation kit (Illumina). The PCR amplification conditions were one cycle of 98°C for 45 sec ...
-
bioRxiv - Neuroscience 2020Quote: ... In our study these NGS primer pairs consisted of eight different forward and 12 different reverse primers (based on Illumina adapters [N/S/E]501-[N/S/E]508 and N701-N712) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and two different mate-pair libraries (3 kb and 5 kb) were prepared with a Nextera Mate Pair Library Prep Kit (Illumina). Sequencing libraries were run on the Illumina Hiseq 2500 sequencer with a read length of 150 bp ...
-
bioRxiv - Cell Biology 2022Quote: ... a PCR enrichment step was performed (8 cycles) using unique primer pairs for each library (NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1).
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2022Quote: ... The library from each genotype was indexed using Unique Dual Index Primer Pairs (NEBNext Multiplex Oligos for Illumina) in order to perform multiplexed sequencing.
-
bioRxiv - Evolutionary Biology 2024Quote: ... and a qPCR before sequencing on two lanes of Illumina 2500 HiSeq pair-end 150bp sequencing (Illumina, USA) at the GeneWiz (New Jersey ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using unique dual index primer pairs (NEBNext Multiplex Oligos for Illumina from New England BioLabs, # E6440S) according the following parameters ...
-
bioRxiv - Molecular Biology 2022Quote: ... generally according to the manufacturer’s instructions and using custom primer pairs compatible with TrueSeq Small RNA Sample Preparation Kit (Illumina), bearing a unique tag for each library ...
-
bioRxiv - Plant Biology 2022Quote: ... The second-round PCR was performed using primer pairs with 16 unique indices: D501-D508 and A501-A508 (forward) and D701-D712 and A701-A712 (reverse) (Illumina).
-
bioRxiv - Genomics 2023Quote: ... qPCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1, E7335) and amplified to linear phase (3-5 PCR cycles).
-
bioRxiv - Bioengineering 2020Quote: ... the V3-V4 hypervariable region of the bacterial 16S rRNA gene pool of the DNA extracts was amplified by PCR using the pair of 341f/806r primers prior to sequencing of PCR products using a HiSeq 2500 sequencer (Illumina, USA). A detailed description of the wet-lab and dry-lab workflows can be found in Supporting Information S5.
-
bioRxiv - Neuroscience 2022Quote: ... Pair-end reads of cDNA sequences were aligned back to the human genome (UCSC hg19 from Illumina iGenome) by the spliced read mapper TopHat (v2.0.4 ...
-
bioRxiv - Genomics 2020Quote: ... Mate-pair libraries were prepared using a Nextera Mate Pair Sample Prep Kit (Illumina), employing our customized iMate protocol25 (http://www.clst.riken.jp/phylo/imate.html) ...
-
bioRxiv - Plant Biology 2020Quote: ... Mate-pair libraries were prepared with a Nextera Mate-pair sample preparation kit (Illumina) with 5000 ng of DNA as the input ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and a mate-pair library constructed using Nextera Mate Pair Library Preparation Kit (Illumina) sequenced using three target insert sizes 3Kb ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Microbiology 2020Quote: ... with library preparation and sequencing performed using primer pair 515F and 806R in 300 bp paired end run on an Illumina MiSeq (Illumina, San Diego). Sequencing data was analyzed using QIIME2 version 2019.7.0 (25 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Genomics 2021Quote: ... beta values from Illumina HumanMethylation27 (HM27 ...
-
bioRxiv - Microbiology 2021Quote: ... and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina, New England Biolabs) attached to the forward primer and the reverse primer ...
-
bioRxiv - Microbiology 2024Quote: ... The V4 – V5 region of the 16S rRNA gene was amplified with the 515F/926R primer pair (45,46) and sequenced on the MiSeq platform (Illumina, Inc., San Diego, CA).
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Developmental Biology 2021Quote: ... Final library concentrations were determined by qPCR using custom primers and exogenously added PhiX DNA (Illumina) to generate a concentration reference curve ...
-
bioRxiv - Immunology 2020Quote: ... read pairs were trimmed from Illumina adapters using cutadapt (version 1.14 ...
-
bioRxiv - Cell Biology 2024Quote: ... Pair-ends reads obtained from Illumina NovaSeq were processed and mapped to the human-SARS-CoV-2 combined reference genome using STAR and Samtools package implemented via Split Bio data analysis pipeline ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and mate-pair libraries of 3 kb insert size were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We then assessed library quality using the HS DNA Kit (Agilent ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and mate-pair libraries of 3-kb insert size were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We performed DNA shearing for the fragment and mate-pair library preparations using Covaris S220 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang). PCRs were performed with Q5 High-fidelity DNA polymerase (NEB ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... A library was prepared by adaptor ligation with the PCR primer pairs using the TruSeq Nano DNA Library Prep Kit (Illumina, Inc., San Diego, CA, USA). When two or more bands were detected using 1.5%-agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2024Quote: ... and controls (n=30) were amplified using PCR with the F515 and R806 primer pair and sequenced using Illumina MiSeq platform (Illumina Inc., San Diego, CA, USA) (82) ...
-
bioRxiv - Cancer Biology 2022Quote: All 450K array methylation level files were downloaded (Data Type: “Methylation beta value”, Platform: “Illumina Human Methylation 450”; n = 507). The average CpG methylation level over DMRs identified in this study and GENCODE transcript promoters was calculated in all TCGA LUAD and matched normal samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Plant Biology 2021Quote: ... and Illumina Mate Pair Library kit (Illumina) following the manufacturer’s instructions (Supplemental Table S1) ...
-
bioRxiv - Genetics 2022Quote: ... and 33M read pairs (150PE, Illumina Novaseq6000) for Bgl614 and Bgl5781 ...