Labshake search
Citations for Illumina :
451 - 500 of 8981 citations for Human Matrix Metalloproteinase 13 Collagenase 3 MMP13 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... using the Illumina DNA Prep kit and unique dual indexes (Illumina Nextera Index kit) at 1:4 scale reaction volume ...
-
bioRxiv - Genomics 2020Quote: ... CNV analysis was performed on a combined cohort of 130 sequenced hESC lines and a control cohort consisting of 243 human samples from primary blood or lymphoblastoid cell lines (LCL) that had undergone WGS on the same platform (Illumina HiSeqX) and to similar depth as the hESC lines (Pato et al. ...
-
bioRxiv - Molecular Biology 2021Quote: Libraries from human liver tissue and wild type FL83B cells were prepared with TruSeq Stranded Total RNA Library Prep Gold (Illumina, #20020599), single-read sequencing was performed using the NextSeq 500 (Illumina) ...
-
bioRxiv - Cancer Biology 2020Quote: ... We used summarized log-scale intensities representing copy number profiles generated by combining probe intensities from four platforms (Agilent Human Genome CGH Microarray 44A, Nimblegen HG19 CGH 385K WG Tiling v2.0, Affymetrix GeneChip Human Mapping 500k Array Set and Illumina Human1Mv1_C BeadChip). A threshold of ≥ 0.9 and ≤ -0.9 was used to call copy number gains and losses ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The resulting cRNA samples were hybridized to an Illumina Human WG6 Expression BeadChip array for 14-20 hour at 58°C in an Illumina Hybridization Oven (Illumina Inc.). Arrays were washed and scanned following the protocols in the Illumina Whole-Genome Gene Expression Direct Hybridization Assay Guide (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting FASTQ files were aligned to the human reference genome (build GRChg38) and transcript abundance was quantified using salmon (Illumina DRAGEN). The DESeq2 package was used to identify differentially expressed transcripts between the H3.3E50K and wildtype H3.3 expressing HMECDD cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... (M) Tagmentation kit (Illumina, 20018705), with 6 cycles of amplification ...
-
bioRxiv - Genomics 2019Quote: ... and Mate-pair Kit (Illumina), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 500 cycle kit (Illumina, UK) at an 8 pM loading concentration with a 10 % PhiX spike-in ...
-
bioRxiv - Microbiology 2020Quote: ... and NexternaRTM Index Kit (Illumina). All cultured isolates (n=43 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... library preparation (Illumina TruSeq kit), and sequencing (Illumina Hi-Seq ...
-
bioRxiv - Physiology 2022Quote: TruSeq mRNA library kit (Illumina) was used to prepare the mRNA library following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... using Swiftbio kit from Illumina. In brief ...
-
bioRxiv - Molecular Biology 2022Quote: TruSeq Stranded mRNA kit (Illumina) was used for library preparation from total RNA according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: Nextera XT V2 kit (Illumina) sequencing libraries were prepared using 1.5ng of amplified cDNA as per manufacturer’s instructions and sequenced on a 2×150 bp-paired end Illumina MiSeq run ...
-
bioRxiv - Microbiology 2021Quote: ... TruSeq Stranded mRNA kit (Illumina) was used for subsequent steps of cDNA strand synthesis ...
-
bioRxiv - Microbiology 2020Quote: ... The Nextera XT kit (Illumina) was used for library preparation and sequencing was performed using a MiSeq v2 cartridge on a MiSeq sequencer (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... and Nextera Index Kit (Illumina) primers followed by reverse phase 0.65 x SPRI beads purification and a QIAquick Spin Column (QIAGEN ...
-
bioRxiv - Molecular Biology 2022Quote: ... (M) Tagmentation kit (Illumina, 20018705), with 6 cycles of amplification ...
-
bioRxiv - Microbiology 2022Quote: ... Kapa Library Quant kit (Illumina) and Universal qPCR mix (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... the RiboZero Bacteria Kit (Illumina) was used as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... (M) Tagmentation Kit (Illumina, Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... MiSeq Reagents Kit v3 (Illumina) were used according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 75-cycle kits (Illumina #20024906).
-
bioRxiv - Genomics 2023Quote: ... The Nextera HT kit (Illumina) was used to convert cDNA libraries into sequencing libraries with the addition of a UMI-specific primer to amplify the cDNA ends containing molecular barcodes as described in the Smart-seq3 protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 cycles kit (Illumina, USA). The output was ∼ 25 million single end- 120 bp reads per sample.
-
bioRxiv - Evolutionary Biology 2023Quote: ... the Nextera XT kit (Illumina) was used in a paired-end (2×300 bp ...
-
bioRxiv - Microbiology 2023Quote: ... using the RiboZERO Kit (Illumina), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 300 cycle reagent Kit (Illumina) in a paired-end fashion (150 × 2).
-
bioRxiv - Genomics 2023Quote: ... using NovaSeq Reagent Kits (Illumina) and the SBS (Sequence By Synthesis ...
-
bioRxiv - Microbiology 2024Quote: ... (M) Tagmentation Kit (Illumina Co.), and sequencing was run with the MiSeq Reagent Kit v3 (2 × 300 bp) ...
-
bioRxiv - Microbiology 2024Quote: ... The Nextera XP kit (Illumina) was used to prepare the sequencing library for sequencing on the HiSeq 2500 and NextSeq 1000 instruments (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... Ribo-Zero Plus Kit (Illumina) was employed for host ribosomal RNA depletion ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NextSeq 500 instrument (Illumina) or NovaSeq instrument (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries that passed QC (>3 ng/μL) were sequenced using an Illumina HiSeq sequencer (Illumina, San Diego, CA, USA) with the paired-end 150-bp sequencing model based on >5G raw data output per sample.
-
bioRxiv - Microbiology 2020Quote: ... 3 to 12 µl of extracted RNA was depleted of rRNA using Ribo-Zero Gold H/M/R (Illumina) and then reverse-transcribed using random hexamers and SuperScript IV (ThermoFisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by library preparation according to the manufacturer’s recommendations (Single Cell 3’ V3 assay) and sequencing on a HiSeq4000 instrument (Illumina). Libraries were de-multiplexed ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Physiology 2022Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NovaSeq 6000 (Illumina) with 26 bases for read1 and 98×8 bases for read2.
-
bioRxiv - Genomics 2019Quote: ... Genotyping was carried out using the Infinium II HumanHap 550K Genotyping BeadChip version 3 (Illumina, San Diego, California USA). Collection and purification of DNA have been described previously (Kayser et al. ...
-
bioRxiv - Immunology 2020Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina, San Diego, CA) to perform the sequencing.
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA sequencing was performed on an Illumina MiSeq at RBGK with version 3 chemistry (Illumina, San Diego, CA, USA) and ran for 600 cycles to generate 2 × 300 bp paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... Short-read sequencing of strain 3-1B was conducted on the Illumina MiSeq platform (Illumina, San Diego, CA, USA) using the NEBNext Ultra II FS DNA library prep kit (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... The library was spiked with 10% of 12.5 pM PhiX and sequenced using 150 cycles of MiSeq version 3 chemistry (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared according to the manufacturer’s protocol using 10X Single-Cell 3’ v3.1 chemistry (10X Genomics, PN-1000128) and sequenced on the NovaSeq platform (Illumina).
-
bioRxiv - Immunology 2023Quote: ... using the Chromium Single Cell Gene Expression Solution 3’ v2 (10x Genomics) and sequenced by the DNA Sequencing Facility (RRID: SCR_017759) using NovaSeq6000 (Illumina) with read lengths of 29-bp + 90-bp (Read1 + Read2) ...
-
bioRxiv - Microbiology 2023Quote: Metagenomic shotgun sequencing was performed at the Norwegian Sequencing Centre on two lanes of the HiSeq 3/4000 (Illumina) generating 150 bp paired-end reads in both lanes ...