Labshake search
Citations for Illumina :
301 - 350 of 9817 citations for Human Cytochrome P450 Family 4 Subfamily F Member 2 CYP4F2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA expression log intensity levels (Illumina Human v3 microarray) were used as the expression levels of the genes ...
-
bioRxiv - Microbiology 2019Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... version 2 (Illumina) using 10 PCR cycles ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4) tagmentation was performed with 2ng input and sequencing library generated using the Nextera XT library prep kit (Illumina, #FC-131-1024). In short ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Genomics 2020Quote: ... Poly-A-enriched RNA was used to prepare libraries with TruSeq RNA Sample Preparation kit v2 y v4 (ref. RS-122-2001/2, Illumina) according to instructions from manufacturer followed by single-end (run1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Long mRNA libraries (2 replicates per time-point) were built using the TruSeq Stranded mRNA HT Sample Prep Kit (Illumina). Library concentration was assessed for all libraries using the Qubit fluorimetric system (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: VH and VL libraries from sorted B cell were subjected to NGS on the MiSeq platform with the reagent kit V3 2×300 bp paired-end (Illumina), using an input concentration of 16pM with 5% PhiX.
-
DNA and RNA-SIP reveal Nitrospira spp. as key drivers of nitrification in groundwater-fed biofiltersbioRxiv - Physiology 2019Quote: ... paired-end 16S rRNA amplicon sequencing was done on the Illumina MiSeq platform with MiSeq Reagent Kit v3 (2 × 301 bp; Illumina). All sequencing was performed at the National High-throughput DNA Sequencing Center (Copenhagen ...
-
bioRxiv - Pathology 2019Quote: ... Two hundred picomolar pooled libraries were utilized per flowcell for clustering amplification on cBot using HiSeq 3000/4000 PE Cluster Kit and sequenced with 2×75bp paired- end configuration on HiSeq4000 (Illumina) using HiSeq 3000/4000 PE SBS Kit ...
-
bioRxiv - Genomics 2019Quote: ... We normalized in 2 different quantities: 130 pg and 750 pg were used as input for the Nextera XT kit (Illumina). The Nextera technology uses a modified tranposase to fragment and ligate adapters in a unique step called “tagmentation” ...
-
bioRxiv - Genomics 2019Quote: ... and three mate-pair libraries (insert sizes of 2 kb, 5 kb, and 8 kb) were constructed using the TruSeq PCR-free Kit (Illumina) and Mate-pair Kit (Illumina) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The RNA-seq library was prepared using 2 µg of total RNA with a TruSeq sample prep kit v2 (Illumina) according to the manufacture’s protocol and analyzed by single-end sequencing using NextSeq (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... The indexed libraries were pooled and diluted to 1.5pM for paired end sequencing (2× 81 cycles) on a NextSeq 500 instrument using the v2 150 cycle High Output kit (Illumina) as per manufacturer’s instructions (generating 80bp paired-ends) ...
-
bioRxiv - Genomics 2021Quote: ... Paired-end sequencing was completed using NextSeq 500/550 300-cycle High-Output Kits v 2.5 (Illumina; 2 × 150 cycles). High-Output kit used for the generation of the NextSeq data allows for over 25 times more sequence data to be generated compared to MiSeq v2 sequencing (800M versus 30M paired reads ...
-
bioRxiv - Genomics 2020Quote: PDT and ATAC libraries were pooled and paired-end sequenced (2 x 34 cycles) using Nextseq High Output Cartridge kits on a Nextseq 550 machine (Illumina). Raw sequencing data were demultiplexed with CellRanger-ATAC mkfastq ...
-
bioRxiv - Genomics 2021Quote: ... ChIP-seq libraries were prepared using the ThruPLEX DNA-seq Kit (Rubicon) and sequenced paired-end 2 x 100bp on the HiSeq 2500 (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... 10 cycles per index and 120 cycles for read 2 on a NextSeq 500/550 High Output Kit v2.5 (Illumina, 20024907).
-
bioRxiv - Systems Biology 2021Quote: ... NGS was performed on a final adjusted library pool using the paired-end 300-cycle NovaSeq 6000 S2 XP Reagent Kit (2 × 150 bp) on a NovaSeq instrument (both Illumina) per the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... Concentration of each sample in the pooled libraries were determined using the paired-end 300-cycle MiSeq Reagent Nano Kit v2 (2 × 150 bp) on a MiSeq instrument (both Illumina). NGS was performed on a final adjusted library pool using the paired-end 300-cycle NovaSeq 6000 S2 XP Reagent Kit (2 × 150 bp ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 bases for index 1 and 8 bases for index 2) using the NextSeq 500 High Output Kit 75-cycles (#FC-404-1005, Illumina) loaded at 1.8pM and including 1 % PhiX ...
-
bioRxiv - Microbiology 2020Quote: ... The libraries were sequenced on the MiSeq™ platform using the MiSeq™ Reagent Kit v3 (2 × 250 bp; Illumina).
-
bioRxiv - Microbiology 2020Quote: ... Multiplexed paired-end libraries (2 × 150 bp) were prepared using the Nextera XT DNA kit (Illumina, San Diego, CA, USA) and eventually sequenced with an Illumina NextSeq-500 instrument at a minimum of 50X coverage depth ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Immunology 2020Quote: ... The indexed libraries were pooled and diluted to 1.5pM for paired end sequencing (2× 76 cycles) on a NextSeq 500 instrument using the v2 150 cycle High Output kit (Illumina) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing was performed by employing an Illumina HiSeq 2500 system and the HiSeq Rapid SBS kit V2 (2×250 bp) as recommended by the manufacturer (Illumina). Metagenomic reads were further processed as described previously (Eze et al ...
-
Peripheral neuropathy linked mRNA export factor GANP reshapes gene regulation in human motor neuronsbioRxiv - Neuroscience 2021Quote: The RNA-seq libraries were made with NEBNext Ultra II Directional (PolyA) kit and sequenced with NovaSeq SP 2×150bp (Illumina) at Biomedicum Functional Genomics Unit (FuGU) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was diluted to 0.2 ng/μL in nuclease-free water and processed for sequencing using the Nextera XT DNA Library Prep Kit (Illumina).
-
bioRxiv - Cell Biology 2022Quote: ... cells were pooled and sequenced on an Illumina NextSeq instrument using 2×75 paired end reads on a NextSeq high output kit (Illumina). Reads were mapped to the Mus musculus mm10 reference genome using STAR ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation and sequencing was performed by the Innovative Genomics Institute Next-Genration Sequencing Core using MiSeq V2 Micro 2×150bp kit (Illumina). Reads were trimmed and merged (Geneious Prime ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The ~2 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina) as previously described [79] ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We then generated retinal transcriptomes from four F1 from the cross using a TruSeq RNA Sample preparation kit v.2 (Illumina) and sequenced on an Illumina HiSeq1000 with 100 bp single-end reads ...
-
bioRxiv - Systems Biology 2020Quote: ... DNA was diluted to 0.2 ng/uL in nuclease-free water and processed for sequencing using the Nextera XT DNA Library Prep Kit (Illumina).
-
bioRxiv - Systems Biology 2019Quote: ... Pooled libraries were utilized for clustering amplification on cBot using HiSeq 3000/4000 PE Cluster Kit and sequenced with 2×75bp paired-end configuration on HiSeq4000 (Illumina) using a HiSeq 3000/4000 PE SBS Kit ...
-
bioRxiv - Microbiology 2020Quote: ... Amplicon sequencing was performed on an Illumina MiSeq platform using Reagent Kit v2 [2×250 cycles] (Illumina Inc., CA, US). The MiSeq Controller Software Casava 1.8 (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were sequenced using a MiSeq sequencing system and MiSeq V3 (2 × 300 bp) reagent kits (Illumina, San Diego, CA).
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing was performed on Illumina HiSeq 4000 paired-end at 2 × 126 bp using the TruSeq SBS kit v4-HS (Illumina).
-
bioRxiv - Genomics 2019Quote: ... (2) six cases prepared with the Nextera Mate-pair Library Construction Kit (hereafter called Nextera, Illumina, San Diego, CA, USA) released by the 1000 Genomes Project 25 were used for comparison.
-
bioRxiv - Microbiology 2019Quote: ... and paired-end sequences (2 x 250-bp) were generated on an Illumina MiSeq instrument with a 500-cycle MiSeq Reagent v2 kit (Illumina). Library preparation and sequencing was done at the Genetic Diversity Center Zurich (GDC) ...
-
bioRxiv - Neuroscience 2019Quote: ... cells were pooled and sequenced in an Illumina NextSeq500 instrument using 2 × 75 paired end reads on a NextSeq high-output kit (Illumina). After de-multiplexing the raw reads to single-cell datasets ...
-
bioRxiv - Physiology 2021Quote: ... were clustered and amplified on cBot using HiSeq 3000/4000 PE Cluster Kit and sequenced (2×75 bp paired-end reads) on HiSeq4000 (Illumina) using HiSeq 3000/4000 PE SBS Kit ...
-
bioRxiv - Microbiology 2020Quote: ... The obtained partitions were further processed using the Chromium Single Cell 3’ Reagent Kit (version 2, 10x Genomics) to generate Nextera XT sequencing libraries that were sequenced on a HiSeq3000 (Illumina), using a single flow cell lane for each library.
-
bioRxiv - Microbiology 2020Quote: ... Libraries were prepared using the NEB Next Ultra II kit (New England Biotech, Ipswich, MA) and paired-end sequenced (2×150bp) on a NextSeq system (Illumina). Adaptors were removed using cutadapt v1.10 [28] and reads assembled using SPAdes v3.7.1 [29] ...
-
bioRxiv - Immunology 2021Quote: VH libraries from sorted B cells were subjected to NGS on the MiSeq platform with the reagent kit V3 2 × 300 bp paired-end (Illumina), using an input concentration of 16 pM with 5% PhiX ...
-
bioRxiv - Molecular Biology 2021Quote: The amplicons were sequenced on an Illumina MiSeq platform in 2 × 251 bp paired-end mode using MiSeq Reagent Nano Kit v2 500 cycles (Illumina). The sequenced reads were mapped to the human reference genome hg19 using the methylation analysis tool Bismark v0.18.1 (Babraham Bioinformatics)52 ...
-
bioRxiv - Microbiology 2021Quote: ... The library pool was then loaded into flow cell of MiSeq Reagent Kit V2 (2 × 150 cycles) and sequenced in a MiSeq platform (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The libraries were sequenced on the S4 300 cycle kit flow (2×151 paired end reads) using the XP workflow as outlined by Illumina.
-
bioRxiv - Microbiology 2021Quote: ... The amplicons were sequenced using the Illumina MiSeq 2 × 250 bp platform with a MiSeq Reagent Nano Kit V2 (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... RNA libraries were sequenced using an Illumina NextSeq 550 with the High Output Kit v2.5 -150 Cycles (2 × 75 bp paired-end) (Illumina Inc.).