Labshake search
Citations for Illumina :
451 - 500 of 1057 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... An H37Rv position with an EBR score of x% indicates that the base calls made from Illumina sequencing and mapping to H37Rv agreed with the base calls made from the PacBio de novo assemblies in x% of the Illumina-PacBio pairs ...
-
bioRxiv - Microbiology 2020Quote: ... Paired-end sequencing (250 x 2) was performed on the Illumina MiSeq (Illumina Inc., San Diego, CA). PCR amplification and sequencing were performed by the Cincinnati Children’s Hospital and Medical Center DNA Core.
-
Listeria monocytogenes gene essentiality under laboratory conditions and during macrophage infectionbioRxiv - Microbiology 2022Quote: ... Sequencing was performed in a 2 x 150 bp paired end run on a NextSeq550 instrument (Illumina) using v2.5 midout chemistry.
-
bioRxiv - Microbiology 2019Quote: ... We performed paired end sequencing (2 x 300 bp) using the MiSeq reagent Kit V3 (Illumina Inc.) on the MiSeq system (Illumina Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were sequenced (2 x 150 bp) on the iSeq platform (Illumina, San Diego, CA, USA) at the Central and Northern Arava R&D Center (Israel).
-
bioRxiv - Genomics 2021Quote: ... An H37Rv position with an EBR score of x% indicates that the base calls made from Illumina sequencing and mapping to H37Rv agreed with the base calls made from the PacBio de novo assemblies in x% of the Illumina-PacBio pairs ...
-
bioRxiv - Genetics 2021Quote: ... the DNA sequencing reads (pre-mapped to the X chromosome by Illumina’s ISIS Analysis Software v.2.5.26.1352) were realigned to the GRCh38 X chromosome reference sequence using BWA-MEM in SpeedSeq v0.1.253 ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were pooled and sequenced paired-ended for 2 x 75 cycles on a Nextseq500 sequencer (Illumina) to generate 30–40 million fragments per sample ...
-
bioRxiv - Immunology 2020Quote: ... Then these libraries were sequenced on the Illumina sequencing platform (HiSeqTM 2500 or Illumina HiSeq X Ten) and 125bp/150bp paired-end reads were generated ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were sequenced on the HiSeq4000 with paired end sequencing using 2 x 150 bp reads (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... Paired end sequencing (2 x 100 bp) of these libraries were performed in the HiSeq 2500 (Illumina). Quality control analysis of the raw data using the NGS QC ToolKit was done ...
-
bioRxiv - Genomics 2022Quote: ... Stored nuclei were thawed on ice and the pellet was resuspended in a transposase reaction mixture (25µl 2 x TD buffer, 2.5µl transposase (Illumina) and 22.5µl nuclease-free water) ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were pooled at 3 nM and sequenced on a HiSeq X instrument (Illumina, San Diego, CA) to generate 150 bp paired-end reads (Psomagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Paired-end (2 x 150 bp) reads were collected using the NovaSeq 6000 S4 XP system (Illumina).
-
bioRxiv - Plant Biology 2022Quote: ... Libraries were subjected to 150-bp paired end sequencing on the HiSeq X platform (Illumina Inc., USA). Raw sequence data were cleaned using Trimmomatic (version 0.39 ...
-
bioRxiv - Genomics 2022Quote: ... WGS of tumor-normal pairs was performed on the HiSeq X-Ten platform (Illumina, San Diego, USA), yielding paired-end reads of 2×150 bp length ...
-
bioRxiv - Plant Biology 2022Quote: ... The library was sequenced by paired-end mode using the Illumina Hiseq X platform (Illumina, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... Libraries were sequenced using 2 x 300 bp paired end v3 reagent kit (Illumina, following manufacturer’s protocols). Short read paired-end data were filtered ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were then sequenced for 2 x 150 paired-end reads on either a NovaSeq 6000 (Illumina) with the WUSTL Genome Technology Access Center or Nextseq 550 (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... The libraries were sequenced in paired-end mode using an Illumina HiSeq X instrument (Illumina, CA, USA). The raw reads have been deposited in the DNA Databank of Japan (BioProject accession No ...
-
bioRxiv - Genomics 2023Quote: ... Three runs of paired-end (2 x 150 bp) sequencing were performed on an Illumina MiSeq (Illumina) to generate 25 Gbp of raw data ...
-
bioRxiv - Cell Biology 2024Quote: ... The paired-end RNA sequencing (2 x 150 bp) was performed on a HiSeq 4000 system (Illumina). The sequencing data were converted from base call files to FASTQ files using Illumina’s bcl2fastq v2.2.0 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the MiSeq Reagent Kit v3 supporting 600-cycles of 2 x 300 paired-end reads (Illumina). The resulting sequence reads were filtered following a cut-off of Phred quality scores ≥30 and read length ≥75 bases ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Immunology 2021Quote: ... and sequencing libraries generated with a TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina). Libraries were sequenced on a NextSeq500 platform (Illumina) ...
-
bioRxiv - Biophysics 2021Quote: ... libraries were constructed using Ribo-Zero Magnetic Gold Kit (Human) (Illumina, San Diego, CA, USA) and NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Systems Biology 2022Quote: ... Human DNA samples for the COVID study were subjected to the Infinium MethylationEPIC array (Illumina) at AKESOgen Inc. ...
-
bioRxiv - Genetics 2021Quote: ... we genotyped the genomic DNA with the OmniChip from the Human OmniExpressExome-8v1.2 from Illumina Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA samples were analyzed using Human HT expression BeadChip V4 (Illumina, San Diego, CA, USA). Raw data were processed using the bead array package from Bioconductor (16) ...
-
bioRxiv - Plant Biology 2023Quote: ... Library preparation included the “TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat”-kit (Illumina), ribosomal RNA depletion and a size selection step for 300 bp fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNAs were depleted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genome-wide DNA methylation patterns were evaluated by Infinium Human Methylation 850 K BeadChips (Illumina), which determine the methylation levels of 853,307 CpG sites ...
-
bioRxiv - Biophysics 2023Quote: ... we aligned the trimmed reads to the human reference genome (hg19, downloaded from Illumina’s iGenomes) using Hisat2 94 with “-k 1 –no-spliced-alignment –phred33” parameters and stored them as binary alignment maps (BAM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... stand-alone Ribo-Zero kits [Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat)] (Illumina), Ribo-Zero accompanied by a TruSeq Stranded Total RNA Kit (Illumina) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and a cDNA library from each sample was sequenced using HiSeq 4000 or HiSeq X (Illumina, San Diego). We prepared two biological replicates for each condition to account for the fluctuation among samples ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The final library pools were generated and sequenced on the Illumina X ten platform (Illumina, San Diego, USA) by the Beijing Genomics Institute (BGI ...
-
bioRxiv - Genomics 2020Quote: ... The Omni-ATAC-seq libraries were sequenced using 150 bp paired-end reads on the HiSeq X (Illumina). The obtained sequence reads were mapped to the human hg19 genome by bowtie2.
-
bioRxiv - Plant Biology 2020Quote: ... Then the cDNA libraries were sequenced on an Illumina sequencing platform (HiSeqTM 2500 or Illumina HiSeq X Ten). Three biological replicates samples from each time point were used for library construction and each library was sequenced once ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were then multiplexed and submitted to the sequencing platform (Illumina MiSeq, pair end 2 x 250 bp). Reads with less than 36 bp were discarded and adaptor sequences were removed by Macrogen Inc.