Labshake search
Citations for Illumina :
101 - 150 of 448 citations for Glucosamine N acetyl 6 Sulfatase GNS Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... before single-end sequencing to generate 50 bp reads on the Hi-Seq 4000 platform (Illumina, San Diego, USA).
-
bioRxiv - Genetics 2020Quote: ... The libraries were pooled and loaded at a concentration of 1.8pM with 10% PhiX spike-in for sequencing on an Illumina NextSeq 550 System using Illumina NextSeq 150 Cycle Hi-Output v2.5 kits (Illumina) to achieve a targeted read depth of ∼33,000 reads per nucleus ...
-
bioRxiv - Plant Biology 2023Quote: ... The 5μg total RNA (DNase-treated) was outsourced for the RNA-Seq on Hi-Seq 2000 genome analyzer (Illumina) sequencing platform ...
-
bioRxiv - Genomics 2023Quote: ... about 40 ng purified pre-amplified Hi-C sample was fragmented in two 50 μl tagmentation mix (1x TD buffer and 0.5 μl TDE1 (Illumina Tagment DNA TDE1 Enzyme and Buffer Kit ...
-
bioRxiv - Genomics 2023Quote: ... and sequenced by PacBio Sequel II. Hi-C libraries were prepared following a standard protocol (Belton et al. 2012) and sequenced by Illumina HiSeq 4000 (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... and the libraries were sequenced in pools of 6 (Illumina HiSeq2500 high output flow-cell ...
-
bioRxiv - Cancer Biology 2019Quote: DNA methylation data (Illumina human methylation 450k BeadChip) and clinical information of 8,118 patients across 24 tissue types were obtained from in GDC data portal [29] using TCGAbiolink (Bioconductor package ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: The Infinium Human Methylation EPIC BeadChip (Illumina, USA) array was performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Methylation data (Illumina Human Methylation 450 platform) for TCGA cohorts were downloaded from the Firebrowse website hosed by Broad Institute of MIT and Harvard ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Paired-end Illumina sequencing libraries were prepared and total RNA-seq was performed with the Hi-seq 2500 (Illumina Inc.).
-
bioRxiv - Genomics 2019Quote: The statistical package edgeR (Version 3.7) within the R software suite (Version 3.1) was used to analyse the RNA-seq (Illumina Hi-Seq) data and to identify transcripts significantly differentially expressed between P ...
-
bioRxiv - Microbiology 2020Quote: A NextSeq run was completed on the pooled libraries using the NextSeq 500 hi-output v2 75-cycle kit and Buffer Cartridge (Illumina). Sequence files were downloaded from the MIP NGS server ...
-
bioRxiv - Microbiology 2021Quote: ... A NextSeq run was completed on the pooled libraries using the NextSeq 500 hi-output v2 75-cycle kit and Buffer Cartridge (Illumina). Sequence files were downloaded from the NGS server ...
-
bioRxiv - Plant Biology 2021Quote: ... Libraries were constructed using the Nextera DNA preparation kit and sequenced on an Illumina Hi-Seq 2500 platform (paired-end 125 bp reads) (Illumina). Quality control reports for the raw sequencing reads were generated using FastQC (Andrews ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries for all samples were sequenced as 150 bp paired-end reads on a single lane of Illumina Hi-Seq 4000 (Illumina). Reads were bioinformatically de-multiplexed ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled sequencing libraries were loaded at a concentration of 1.8pM with 10% PhiX spike-in and sequenced using eight Illumina NextSeq 150 Cycle Hi-Output v2.5 kits (Illumina #20024907) on an Illumina NextSeq 550 System ...
-
bioRxiv - Neuroscience 2021Quote: Sequencing of the pooled libraries was completed by the NIDDK Genomics Core on an Illumina NextSeq 550 system using a NextSeq 150 Cycle Hi-Output v2.5 kit (Illumina #20024907), generating a total of 400 million reads for an estimated sequencing depth of 40,000 reads per cell ...
-
bioRxiv - Genomics 2019Quote: ... Two 3rd instar larvae were selected for Hi-C library construction and then sequenced on a HiSeq 2500 platform (Illumina). In addition ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Hi-C libraries were processed to paired-end sequencing on the Illumina Hiseq 4000 (Illumina, San Diego, CA, USA) platform with read length of 150 bp.
-
bioRxiv - Genetics 2022Quote: ... Variants considered causative were validated in the proband and studied in his parents by deep amplicon sequencing performed using Nextera XT Kit (Illumina) and paired-end sequencing as described above for WES.
-
bioRxiv - Genetics 2023Quote: ... Samples were indexed and pairs for each experiment were pooled for sequencing using the NextSeq 500/550 Hi Output KT v2.5 (Illumina #20024907) on an Illumina NextSeq550 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were pooled at a concentration of 5 nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Genomics 2024Quote: The chromatin conformation capture (Hi-C) fragment libraries were constructed from 300-700 bp insert size and were measured by Illumina platform for auxiliary assembly (Rao et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index i7 (6 pb barcode) was read with primer HP8 (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Genomics 2020Quote: ... Human libraries were sequenced on a NovaSeq 6000 (Illumina) and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA expression log intensity levels (Illumina Human v3 microarray) were used as the expression levels of the genes ...
-
bioRxiv - Genomics 2022Quote: Multi-omics data utilized in JHS analyses including methylomics (n = 1,750, Illumina MethylationEPIC BeadChip array) [40] and proteomics (n = 2,144 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified using qPCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) as previously described (Couturier et al ...
-
bioRxiv - Developmental Biology 2019Quote: ... Four nM samples were pooled and run on a NextSeq 500/550 Hi Output Kit (20024907, Illumina, Inc. San Diego, CA) and the NextSeq 500 Illumina Sequencer to obtain paired end reads of 75bp ...
-
bioRxiv - Plant Biology 2021Quote: ... The chimeric fragments were isolated and then constructed to five Hi-C libraries that were sequenced on an Illumina NovaSeq platform (Illumina, USA) with 2×150 bp pair-end reads ...
-
bioRxiv - Genetics 2021Quote: ... These 6 cats were sequenced on a HiSeq2500 (Illumina, San Diego, CA) to generate 100bp paired-end reads ...
-
bioRxiv - Neuroscience 2019Quote: ... and sequenced 6 samples per lane on a HiSeq 2000 sequencer (Illumina) giving a depth of 30-35 million reads per sample.
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced at 101×6×0×101 on a HiSeq (Illumina) to a minimum depth of 30 million reads per sample.
-
bioRxiv - Immunology 2021Quote: ... and mixed with 6 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96– Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR amplified cDNA libraries were run on 6% Novex TBE gels (Illumina), and fragments running between 110-160 bp markers were gel-extracted for subsequent purification ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... “alata” [6] from NCBI Sequence Read Archive (seven 101bp paired-end Illumina libraries ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were sequenced single-end using 50 bp reads on the HiSeq-2500 and Hi-Seq 4000 platforms (Illumina, San Diego, USA).
-
bioRxiv - Genetics 2022Quote: ... Final library concentrations were diluted to 4nM and submitted for sequencing on the Illumina Hi-Seq 2500 (Illumina, San Diego, CA, USA), 125bp SE in the GSL ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cDNA libraries were singe-end sequenced in 76 cycles using a NSQ 500/550 Hi Output KT v2.5 (Cat #20024906 Illumina, San-Diego, CA) in one multiplex run (N=3/exposure group) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 300pM of the pooled library was loaded onto a NovaSeq S1 flowcell (Illumina p/n 20012865), using the Standard Workflow loading conditions designated by the manufacturer and amplified by exclusion amplification (ExAMP ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Cancer Biology 2021Quote: The Illumina Infinium Human Methylation 450k BeadChip (Illumina 450K array) prostate adenocarcinoma dataset was downloaded from the TCGA consortium database ...
-
bioRxiv - Genetics 2019Quote: ... and genotyped on the Infinium Human CoreExome-24 BeadChip (Illumina). Variants missing >5% of total genotypes and variants that deviated from Hardy-Weinberg equilibrium were removed ...
-
bioRxiv - Cancer Biology 2019Quote: ... and TruSeq Stranded Total RNA Human/Mouse/Rat (Illumina, 20020596) with 100 ng of input and 13 PCR cycles ...
-
bioRxiv - Genetics 2019Quote: ... the Ribo-Zero rRNA Removal kit (Human/Mouse/Rat, Illumina) was employed to deplete ribosomal RNA from 20 µg of total human or mouse brain RNA according to the manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The Illumina Infinium® human 450k (Illumina, WG-314-10031) and EPIC methylation (Illumina ...