Labshake search
Citations for Illumina :
1 - 50 of 127 citations for Gentamicin Deuterated C Complex Pentaacetate Salt Contains d0 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... which contains the different adapters used by Illumina was used to remove the remaining sequencing adapters ...
-
bioRxiv - Cell Biology 2024Quote: ... The second contains all the RNA fragment sequences produced by Illumina. From here ...
-
bioRxiv - Cancer Biology 2024Quote: ... The WGBS data was filtered to only contain CpG calls from Illumina array probe positions and then merged with public array dataset ...
-
bioRxiv - Microbiology 2020Quote: ... The BarSeq_P2 primer contains the tag that is used for demultiplexing by Illumina software ...
-
bioRxiv - Microbiology 2023Quote: ... the BarSeq_P2 primer contains the tag that is used for demultiplexing by Illumina software ...
-
bioRxiv - Genomics 2023Quote: ... (Grass carp was used as a control as it contains many artifactual Illumina adapters.) To perform these annotations ...
-
bioRxiv - Genetics 2023Quote: ... five forward and five reverse primers contain Nextera transposase adapter sequences (Illumina Document#1000000002694) “TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG” (read 1 ...
-
bioRxiv - Genomics 2023Quote: ... the nuclei flash-frozen in the tube strips were thawed on ice and 13.7 μl of transposition buffer (which contains 12.5 μl of 2X Illumina Tagment DNA Buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reverse oligonucleotides also contain barcode sequences for multiplexing according to the TruSeq v1/v2/LT protocol (Illumina). Sequencing libraries were obtained from 12–16 cycles of PCR using 0.02 μM long NGS adapter oligonucleotides (forward and reverse ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2024Quote: ... it contains another unique 7bp DNA barcode and the standard Illumina TrueSeq i7 sequencing adapter (Illumina, see document: 1000000002694). Round 2 bottom-strand oligo is complementary to its respective round 2 top-strand mate but lacks the 3bp linker sequence.
-
bioRxiv - Microbiology 2020Quote: ... The forward and reverse primers were designed to contain an Illumina® overhang adapter sequence (Illumina®; San Diego, CA, USA) in order to anneal them to primers containing the Illumina® adaptors plus the 8 bp identifier indices ...
-
bioRxiv - Molecular Biology 2022Quote: Adaptor oligonucleotides were synthesized by IDT (Supplementary Table S4).37,38 Transposon assembly was done by incubating 158 μg Tn5 with 1.4 nmol annealed oligo (contains the full-length Illumina forward (i5) adapter ...
-
bioRxiv - Genomics 2024Quote: ... and that HT-SELEX ligands differ from each other by containing a well-specific variable region that flanks the randomized 40 bases indicated in the name of the experiments (e.g. AA40NCCAGTG contains 40-bases flanked by AA and CCAGTG sequences and Illumina adapter sequences). All primers and library preparation schemes are given in Table S1.
-
bioRxiv - Evolutionary Biology 2023Quote: ... we conducted our analyses on Genomic VCF (gVCF) files that contain genotype calls for both variant and invariant sites (Illumina, Inc. 2020). Then ...
-
bioRxiv - Genomics 2021Quote: ... was generated and we incubated 7 µM Tn5059 with 10 µM annealed transposon for 30 min at room temperature and then diluted to 0.7 µM Tn5059 transposome complex with standard storage buffer (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... C and D (Illumina). Amplicon concentration across samples was normalized to 200 ng/μl using the Qubit high sensitivity dsDNA assay before pooling ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Microbiology 2021Quote: ... 9) DC3000 − C (Illumina only), 10 ...
-
bioRxiv - Genomics 2020Quote: ... and Hi-C sequencing (Illumina sequencing). The tissue samples were stored in liquid nitrogen before sequencing ...
-
bioRxiv - Genomics 2021Quote: ... platform = c(”Illumina Human Methylation 450”), and sample.type = c(”Primary solid Tumor”,”Solid Tissue Normal”) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... as well as Hi-C (Illumina) chromatin interaction data ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Hi-C sequencing was performed by Illumina HiSeq 2500 platform ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 sec at 62°C and a final extension step of 5 min at 62°C) and sequenced using the NOVASeq platform (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... 19bp single end sequencing (Illumina-C HiSeq 2500).
-
bioRxiv - Cancer Biology 2021Quote: ... All Hi-C libraries were sequenced by Illumina sequencing ...
-
bioRxiv - Genomics 2023Quote: ... and Hi-C (Illumina NovaSeq 6000, 2×150bp) for chromosome-level scaffolding (Fig ...
-
bioRxiv - Pathology 2024Quote: ... aphidicola (C, D) based on SNPs identified from Illumina sequencing ...
-
bioRxiv - Genomics 2022Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... equimolar amounts of the libraries underwent a c-Bot (Illumina) bridge PCR followed by single end sequencing for 77 cycles on an Illumina Hiseq2500 ...
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Genomics 2023Quote: ... Illumina Nextera DNA Unique Dual Indexes Set C (Illumina, 20027215) were added and amplified (12 cycles ...
-
bioRxiv - Genomics 2024Quote: ... Illumina Nextera DNA Unique Dual Indexes Set C (Illumina, 20027215) were added and amplified (12 cycles ...
-
bioRxiv - Neuroscience 2022Quote: ... The pool was adjusted to 10pM for clustering on C-Bot (Illumina) and then sequenced Paired-End 101 bases using the HiSeq SBS Kit v4 (Illumina ...
-
bioRxiv - Systems Biology 2023Quote: ... 62 °C for 5 min) using Nextera i5/i7 indexing primers (Illumina) and 2x KAPA HiFi HotStart ready-mix (KAPA Biosystems) ...
-
bioRxiv - Genomics 2024Quote: ... Then the CHi-C library was sequenced (paired-end 150bp, Illumina NovaSeq6000) for a total of 500 million reads per replicate ...
-
bioRxiv - Genomics 2021Quote: We downloaded publicly-available Hi-C data from human prefrontal cortex tissue23,24 (Illumina HiSeq 2000 paired-end raw sequence reads ...
-
bioRxiv - Genomics 2020Quote: ... Hi-C libraries were paired-end sequenced on a NovaSeq 6000 system (Illumina). Raw data were processed with the ENCODE 4 pipeline for Hi-C according to ENCODE 4 standards (https://www.encodeproject.org/documents/75926e4b-77aa-4959-8ca7-87efcba39d79/).
-
Dual symbiosis in the deep-sea hydrothermal vent snail Gigantopelta aegis revealed by its hologenomebioRxiv - Genomics 2020Quote: ... The Hi-C library was sequenced on a NovaSeq 6000 platform (Illumina, USA) and generated reads with a length of 150 bp ...
-
bioRxiv - Cancer Biology 2022Quote: ... Hi-C libraries were sequenced 2×150bp on a NovaSeq 6000 instrument (Illumina). Juicer were used to process raw reads and generate Hi-C contact matrices (.hic files) ...
-
bioRxiv - Genetics 2022Quote: ... the products from each sample were bulked and applied to c-Bot (Illumina) bridge PCR followed by sequencing on Illumina Hiseq2500 ...
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was sequenced on a NovaSeq 6000 platform (Illumina, USA) and generated reads with a length of 150 bp producing 32.08 Gbp of data in total (Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2023Quote: ... Hi-C libraries were sequenced on Illumina NextSeq500 (Illumina, San Diego, CA, USA) platform using platform using High Output Kit v2.5 (150 Cycles).
-
bioRxiv - Genetics 2022Quote: ... Hi-C libraries were paired-end sequenced (61bp+61bp) on a NovaSeq 6000 (Illumina).
-
bioRxiv - Genomics 2020Quote: ... The resulting Hi-C libraries were paired-end sequenced on a NovaSeq6000 platform (Illumina) to >500 million read pairs per replicate (Table S1) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then treated for 30 minutes at 37°C with Tn5 transposase (Illumina, 20034197). The DNA was extracted using DNA Clean and Concentrator 5-kit (Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... The transposition reaction was incubated for 30 min or 1h at 37◦C (Illumina Tagment DNA Enzyme and Buffer kit ...
-
bioRxiv - Biochemistry 2024Quote: ... 162.63 Gb Hi-C data (∼168X coverage) were generated using Illumina NovaSeq 6000 (Illumina) for scaffolding the initial assembly onto chromosomal-scaffolds ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were indexed using the IDT for Nextera Unique Dual Indexes Set C (Illumina). In this approach ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... 58°C on two Illumina MouseRef-8 v2.0 Expression BeadChips (Illumina, San Diego, CA, USA). Post-hybridization data read-out ...