Labshake search
Citations for Illumina :
51 - 100 of 333 citations for Fatty acid binding protein FABP1 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Hi-C libraries were sequenced on a NextSeq 550 sequencer (2×75 bp, paired-end Illumina NextSeq with the first ten bases acting as barcodes50).
-
bioRxiv - Genomics 2020Quote: Hi-C data were obtained in the form of unprocessed fastq files (paired-end Illumina reads) for IMR90 cells from the NCBI Gene Expression Omnibus (GEO)-accession GSE43070[12] ...
-
bioRxiv - Genomics 2024Quote: ... The production-scale sequencing of the Hi-C library was performed on a NextSeq2000 sequencer (Illumina) using 150 bp paired-end read mode at the Berlin Center for Genomics in Biodiversity Research.
-
bioRxiv - Microbiology 2024Quote: ... Hi-SC2 libraries were prepared and subjected to pair-end sequencing on a NextSeq 500 (Illumina). After sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... reverse-transcribed using random hexamer primers that introduce Truseq Small RNA kit RP1 primer binding sites (Illumina) and finally converted into DNA libraries using custom rpi primers (RNA PCR Primer Index ...
-
bioRxiv - Genomics 2021Quote: ... platform = c(”Illumina Human Methylation 450”), and sample.type = c(”Primary solid Tumor”,”Solid Tissue Normal”) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Paired-end 2 x 75 bp NSQ 500/550 Hi Output KT v2.5 −75 CYS (Illumina, 20024906) was performed for RNA-seq libraries on an Illumina Nextseq 500 instrument ...
-
bioRxiv - Genomics 2021Quote: ... and (3) 134 Gb (~100× depth) chromosome conformation capture sequencing (Hi-C) data (sequenced by Illumina platform).
-
bioRxiv - Genomics 2022Quote: ... Hi-C libraries were sequenced on a NextSeq 550 apparatus (2 × 75 bp, paired-end Illumina NextSeq). Contact maps were generated from reads using the hicstuff pipeline for processing generic 3C data ...
-
bioRxiv - Neuroscience 2019Quote: ... Paired-end 100 bp sequencing reads were obtained using Illumina Hi-seq 2500 (Illumina, San Diego, CA).
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were sequenced on the Illumina Hi-Seq 2500 Next-Generation-Sequencer (Illumina, San Diego, CA, USA) using 50bp single-end sequencing.
-
bioRxiv - Genomics 2022Quote: ... and DpnII and HindIII Hi-C material was sequenced (2×50 nt) on a HiSeq 4000 (Illumina) following the manufacturer’s instructions) ...
-
bioRxiv - Genomics 2022Quote: ... Chromosome-scale scaffolding was then performed by HiRise44 with Hi-C reads obtained from HiSeq 2500 (Illumina).
-
bioRxiv - Genomics 2021Quote: ... four human CNV membranes and four human RPE-choroidal control tissues) were sequenced on the NextSeq 500 (Illumina) with 1 × 75 bp ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing of the Hi-C library was conducted on an Illumina HiSeq 2500 (Illumina, San Diego, CA, USA) with 101 bp paired-end reads ...
-
bioRxiv - Genomics 2020Quote: ... Uniquely barcoded libraries from single-cells pooled together and sequenced using a HiSeq-Hi-output-2500 sequencer (Illumina). In total ...
-
bioRxiv - Genomics 2022Quote: ... we further sequenced the same libraries on a single lane of rapid flowcell in Hi-seq 2500 (Illumina) at Otago Genomics Facility (OGF) ...
-
bioRxiv - Genomics 2021Quote: BD Infinium Human Methylation 450 arrays (Illumina) were retrieved from the European Genome-phenome Archive (EGA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was done with Illumina NextSeq 500 using NextSeq 500/550 High Output Kit v2.5 for HeLa samples and with Illumina NovaSeq 6000 using partial S4 flow cell lane for patient samples.
-
bioRxiv - Neuroscience 2022Quote: ... A Human OmniExpress v1.2 BeadChip array (Illumina) was used post-editing to check for any gross karyotype abnormalities ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was performed at the Institute for Molecular Medicine Finland FIMM Genomics unit with Illumina NovaSeq 6000 using partial S4 flow cell lane ...
-
bioRxiv - Neuroscience 2020Quote: ... before single-end sequencing to generate 50 bp reads on the Hi-Seq 4000 platform (Illumina, San Diego, USA).
-
bioRxiv - Genetics 2020Quote: ... The libraries were pooled and loaded at a concentration of 1.8pM with 10% PhiX spike-in for sequencing on an Illumina NextSeq 550 System using Illumina NextSeq 150 Cycle Hi-Output v2.5 kits (Illumina) to achieve a targeted read depth of ∼33,000 reads per nucleus ...
-
bioRxiv - Plant Biology 2023Quote: ... The 5μg total RNA (DNase-treated) was outsourced for the RNA-Seq on Hi-Seq 2000 genome analyzer (Illumina) sequencing platform ...
-
bioRxiv - Genomics 2023Quote: ... about 40 ng purified pre-amplified Hi-C sample was fragmented in two 50 μl tagmentation mix (1x TD buffer and 0.5 μl TDE1 (Illumina Tagment DNA TDE1 Enzyme and Buffer Kit ...
-
bioRxiv - Genomics 2023Quote: ... and sequenced by PacBio Sequel II. Hi-C libraries were prepared following a standard protocol (Belton et al. 2012) and sequenced by Illumina HiSeq 4000 (Illumina ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Cancer Biology 2019Quote: DNA methylation data (Illumina human methylation 450k BeadChip) and clinical information of 8,118 patients across 24 tissue types were obtained from in GDC data portal [29] using TCGAbiolink (Bioconductor package ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: The Infinium Human Methylation EPIC BeadChip (Illumina, USA) array was performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Methylation data (Illumina Human Methylation 450 platform) for TCGA cohorts were downloaded from the Firebrowse website hosed by Broad Institute of MIT and Harvard ...
-
bioRxiv - Molecular Biology 2021Quote: ... Paired-end Illumina sequencing libraries were prepared and total RNA-seq was performed with the Hi-seq 2500 (Illumina Inc.).
-
bioRxiv - Genomics 2019Quote: The statistical package edgeR (Version 3.7) within the R software suite (Version 3.1) was used to analyse the RNA-seq (Illumina Hi-Seq) data and to identify transcripts significantly differentially expressed between P ...
-
bioRxiv - Microbiology 2020Quote: A NextSeq run was completed on the pooled libraries using the NextSeq 500 hi-output v2 75-cycle kit and Buffer Cartridge (Illumina). Sequence files were downloaded from the MIP NGS server ...
-
bioRxiv - Microbiology 2021Quote: ... A NextSeq run was completed on the pooled libraries using the NextSeq 500 hi-output v2 75-cycle kit and Buffer Cartridge (Illumina). Sequence files were downloaded from the NGS server ...
-
bioRxiv - Plant Biology 2021Quote: ... Libraries were constructed using the Nextera DNA preparation kit and sequenced on an Illumina Hi-Seq 2500 platform (paired-end 125 bp reads) (Illumina). Quality control reports for the raw sequencing reads were generated using FastQC (Andrews ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries for all samples were sequenced as 150 bp paired-end reads on a single lane of Illumina Hi-Seq 4000 (Illumina). Reads were bioinformatically de-multiplexed ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled sequencing libraries were loaded at a concentration of 1.8pM with 10% PhiX spike-in and sequenced using eight Illumina NextSeq 150 Cycle Hi-Output v2.5 kits (Illumina #20024907) on an Illumina NextSeq 550 System ...
-
bioRxiv - Neuroscience 2021Quote: Sequencing of the pooled libraries was completed by the NIDDK Genomics Core on an Illumina NextSeq 550 system using a NextSeq 150 Cycle Hi-Output v2.5 kit (Illumina #20024907), generating a total of 400 million reads for an estimated sequencing depth of 40,000 reads per cell ...
-
bioRxiv - Genomics 2019Quote: ... Two 3rd instar larvae were selected for Hi-C library construction and then sequenced on a HiSeq 2500 platform (Illumina). In addition ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Hi-C libraries were processed to paired-end sequencing on the Illumina Hiseq 4000 (Illumina, San Diego, CA, USA) platform with read length of 150 bp.
-
bioRxiv - Genetics 2022Quote: ... Variants considered causative were validated in the proband and studied in his parents by deep amplicon sequencing performed using Nextera XT Kit (Illumina) and paired-end sequencing as described above for WES.
-
bioRxiv - Genetics 2023Quote: ... Samples were indexed and pairs for each experiment were pooled for sequencing using the NextSeq 500/550 Hi Output KT v2.5 (Illumina #20024907) on an Illumina NextSeq550 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were pooled at a concentration of 5 nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Genomics 2024Quote: The chromatin conformation capture (Hi-C) fragment libraries were constructed from 300-700 bp insert size and were measured by Illumina platform for auxiliary assembly (Rao et al. ...
-
bioRxiv - Microbiology 2023Quote: ... second BsmBI site (producing cut-edge between the base pairing region and dCas9 handle binding region) and read2 (Illumina sequencing element) was amplified from pPEPZ-sgRNAclone (Addgene# 141090 ...
-
bioRxiv - Genomics 2020Quote: ... Human libraries were sequenced on a NovaSeq 6000 (Illumina) and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA expression log intensity levels (Illumina Human v3 microarray) were used as the expression levels of the genes ...
-
bioRxiv - Developmental Biology 2019Quote: ... Four nM samples were pooled and run on a NextSeq 500/550 Hi Output Kit (20024907, Illumina, Inc. San Diego, CA) and the NextSeq 500 Illumina Sequencer to obtain paired end reads of 75bp ...