Labshake search
Citations for Illumina :
201 - 250 of 9073 citations for Estrone 3 Sulfate E1S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: Small RNA libraries were prepared starting from 5 µL RNA eluate using the TruSeq Small RNA Library Prep Kit (Illumina, RS-200-0012 ...
-
bioRxiv - Cancer Biology 2023Quote: RNA-seq libraries were prepared with 0,5-1 µg of total high quality RNA collected from samples and the Illumina Stranded Total RNA Prep kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Genomics 2020Quote: ... and libraries were constructed by the Lexogen QuantSeq 3’ mRNA-Seq Library Kit FWD (Lexogen, Vienna, Austria).19 All RNA libraries were sequenced by the Illumina HiSeq4000 (Illumina, San Diego, CA). Raw sequencing data were aligned to the reference genome (GRCh37 ...
-
bioRxiv - Genetics 2021Quote: ... Libraries constructed with the Lexogen QuantSeq 3′ mRNA-Seq Library Kit FWD (Lexogen, Greenland, NH) were sequenced on an Illumina NextSeq 500 (Illumina, San Diego, CA) at the Genomics Facility of the Cornell Institute of Biotechnology.
-
bioRxiv - Microbiology 2021Quote: ... Goe13 and lysogens and sequenced with the MiSeq system and reagent kit V.3 (2 x 300 bp) (Illumina, San Diego, CA, USA) and the NovaSeq system (2x 150bp ...
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Immunology 2021Quote: ... 1.5 ng cDNA was tagmented using 0.5 μl TruePrep Tagment Enzyme V50 and 1x TruePrep Tagment Buffer L (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme), followed by an incubation step at 55 °C for 10 min ...
-
bioRxiv - Microbiology 2021Quote: Purified PCR products were given unique dual indexes at the 5’ end using the Nextera XT Index Kit v2 index primers (Illumina, USA). To attach the index primers ...
-
bioRxiv - Immunology 2020Quote: ... Supernatant was discarded and nuclei were re-suspended in 50 μl reaction buffer containing 5.0 μl Tn5 transposase and 10 μl of 5 × TTBL buffer (TruePrepTM DNA Library Prep Kit V2 for Illumina, Vazyme Biotech). The reaction was incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... Samples were concentrated using a centrifugal evaporator Speed Vac® to a final volume of 5 μl and we started the TruSeq Small RNA Sample Preparation Kit (Illumina) protocol according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: Sequencing libraries were prepared from 100 ng DNA using the TruSeq Nano DNA sample preparation kit (cat# 20015964/5, Illumina Inc.) targeting an insert size of 350bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Extracted nuclei was processed for TN-5 mediated tagmentation using the Illumina Tagment DNA Enzyme and buffer kit (Nextera Illumina # 20034210) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Ribosomal RNAs were depleted from 5 μg of total RNA of the sample by Ribo-Zero rRNA Removal Kit (Seed, Root) (Illumina®). After rRNA depletion ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nextera libraries (5 replicates) were constructed from 0.8 ng of pre-amplified cleaned up cDNA using Nextera XT Kit (Illumina, Eindhoven, Netherlands). Index PCR was carried out using the custom P5 primer (P5NEXTPT5 ...
-
bioRxiv - Neuroscience 2023Quote: ... and a duplicate unrelated control sample was diluted to 5 ng/µl in low TE provided in AmpliSeq Library PLUS (384 Reactions) kit (Illumina, 20019103). AmpliSeq was carried out following the manufacturer’s protocol (document 1000000036408v07) ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared from 700 ng total RNA using the TruSeq stranded mRNA library preparation kit (Cat# 20020594/5, Illumina Inc.) including polyA selection ...
-
bioRxiv - Microbiology 2023Quote: ... Amplicon libraries were mixed with 5% PhiX and sequenced with MiSeq reagent kits v2 500 cycles (Illumina, San Diego, California, USA). A blank extraction kit control ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Sequencing libraries were prepared by transposase-assisted tagmentation and enrichment of 3’end of genes using Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA, USA). The libraries were sequenced on the HiSeq2500 for 25 and 75 cycles paired-end reads ...
-
bioRxiv - Genomics 2023Quote: ... RNA was extracted from similar pooled-samples (N = 3) using the ZYMO (Irvine, CA, USA) direct-zol miniprep kit (Cat. # R2050) and sequenced using NovaSeq (Illumina, San Diego, CA, USA) paired-end (150 bp ...
-
bioRxiv - Immunology 2024Quote: ... China), using Chromium Single Cell 3’ Reagent Kits v2 (from 10x Genomics, Pleasanton, CA, USA) and NovaSeq 6000 System (Illumina, San Diego, CA, USA) respectively ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared following 10X Genomics protocols (Chromium Single Cell 3’ Reagent Kits v2 Chemistry) and sequenced on NovaSeq 6000 (Illumina S2 flow cell, paired-end). FASTQ files were processed using cellranger (https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lysed for 5 min followed by transposase reaction and library amplification using Nextera DNA Library Prep Kit (Illumina, California, USA). Libraries were then size-selected (240-360 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Developmental Biology 2023Quote: ... and TruSeq RNA CD Index Plate (Illumina, USA) for sample multiplexing ...
-
bioRxiv - Genomics 2019Quote: ... the nuclei pellets were resuspended in transposase Master Mix (1.25 μl 10x TD buffer, 5 μl H2O and 6.5 μl of Tn5: Illumina Nextera Kit; FC-121-1031) and incubated for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... indexing and amplification of the transposed DNA samples was performed by combining 10 µL of transposed DNA with the following: 5 µL of the Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121-1011), 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 TLX1/TLX3 and 5 HOXA) was performed using the TruSeq Stranded Total RNA (w/RiboZero Gold) sample prep kit (Illumina, RS-122-2301), involving depletion of ribosomal (rRNA ...
-
bioRxiv - Genomics 2021Quote: ... RNA-seq libraries were prepared from 500 ng total RNA using the TruSeq stranded mRNA library preparation kit (Illumina Inc, Cat# 20020594/5) including polyA selection ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification and index incorporation were performed in a 50 μl reaction containing 5 μl of forward and reverse index primers (Illumina Nextera Index Kit), 15 μl NPM ...
-
bioRxiv - Genomics 2020Quote: ... Individual cells were sequenced to a mean depth of ~1.5 million 38 bp paired-end reads on an Illumina NextSeq 500 instrument with 75 cycle high output kits (Illumina TG-160-2005).
-
bioRxiv - Microbiology 2024Quote: Total RNA of 5 μg was used to construct strand-specific RNA-sequencing libraries using the TruSeq RNA sample preparation Kit from Illumina (San Diego, CA). Briefly ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...