Labshake search
Citations for Illumina :
251 - 300 of 9199 citations for Estrone 3 Sulfate E1S ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng of amplified RNA was used to prepare cDNA libraries (Nextera XT DNA library preparation kit; Illumina). cDNA libraries for 4 biological replicates for both control (THD’GAL4/+ ...
-
bioRxiv - Systems Biology 2020Quote: ... Ten C1 plates were combined for analysis using the NovaSeq 6000 System (Illumina). We used SingleR to cluster by cell types per subject and we analyzed enrichment of KEGG pathways per cell type.
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sequencing libraries were prepared from 1 μg total RNA using the TruSeq Standard mRNA LT Sample Preparation Kit (Illumina) and sequenced by Illumina NextSeq500 (Illumina ...
-
Enterobacter sp. SA187 mediates plant thermotolerance by chromatin modification of heat stress genesbioRxiv - Plant Biology 2020Quote: We performed mRNA libraries with 1 µg of total plant RNA using a stranded mRNA Library Prep kit (Illumina). Pooled libraries were sequenced using Illumina HiSeq 4000 platform which resulted in paired-end reads of length 151 bps ...
-
bioRxiv - Molecular Biology 2019Quote: ... Initial RNA-seq libraries were made using the TruSeq RNA prep kit by Illumina (shW, shSv210-1, shSv210-2). A second set of libraries from shW ...
-
bioRxiv - Genetics 2020Quote: ... were incubated in a 50 µl reaction with 0.8 µl of Tn5 transposase at 1× TD buffer from the Nextera library preparation kit (Illumina) for 5 min at 55°C ...
-
bioRxiv - Genomics 2021Quote: ... Complementary DNA (cDNA) libraries were prepared from 1 μg RNA using TrueSeq RNA Sample Prep Kit (Illumina, California, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were sequenced according to the Illumina user manual with 80 cycles of read 1 (forward) using the NextSeq 500/550 High Output Kit v2.5 (75 Cycles) (Illumina) with the 20% PhiX spike in Illumina PhiX control kit (Illumina).
-
bioRxiv - Pathology 2019Quote: ... NGS libraries were prepared from 1 ng of extracted DNA using Nextera®XT DNA Sample Preparation Kit (Illumina), and sequencing was performed on an Illumina MiSeq sequencer using MiSeq Reagent Kit v2 (500-cycles ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA libraries were prepared using 1 µg of total RNA using the TruSeq RNA Sample Preparation Kit v2 (Illumina). RNA quality was assessed by an Agilent Bioanalyzer 2100 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cDNA was diluted to an average of 200 pg/µl and 100 pg cDNA from each cell was tagmented by adding 1 µl TD and 0.5 µl ATM from a Nextera XT DNA Library Preparation Kit (Illumina) to 0.5 µl diluted cDNA in each well of a fresh 384-well plate ...
-
bioRxiv - Immunology 2020Quote: ... RNA-Seq libraries were prepared using 1 μg of end-repaired cDNA using the TruSeq Stranded RNA Kit (Illumina), however due to the method of amplification the libraries were not stranded ...
-
bioRxiv - Cancer Biology 2019Quote: ... Paired-end sequencing libraries were prepared using 1 μg of purified RNA following the mRNA-Seq Sample Prep Kit according to the manufacturer’s instructions (Illumina). RNA-Seq libraries were sequenced on two lanes each of an Illumina GAIIx Genome Analyser to a minimum depth of 49 million reads ...
-
bioRxiv - Microbiology 2022Quote: ... RNA-Seq libraries were prepared using 1 ug of total RNA with TruSeq Stranded mRNA Library Prep kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sequencing libraries were prepared using 1 μg of total RNA with the TruSeq Stranded mRNA Sample Prep Kit (Illumina) and the TruSeq single-index adaptor (Illumina) ...
-
bioRxiv - Immunology 2023Quote: ... The samples were sequenced in a paired-end run (read 1: 28bp, read 2: 91bp) on a NovaSeq6000 platform using S1 v1.5 (100 cycles) sequencing kits (Illumina). Bcl2fastq software (v2.20.0.422 ...
-
bioRxiv - Microbiology 2023Quote: ... 1 ng of DNA was used to prepare DNA libraries using the Nextera XT DNA Library Preparation Kit (Illumina) and genomic DNA was fragmented with Illumina Nextera XT fragmentation enzyme ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μg RNA and a TruSeq RNA Library Prep Kit v2 (RS-122-2001, Illumina, San Diego, CA, USA) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 ng DNA was used to generate the sequencing library by using Nextera XT DNA Library Preparation Kit (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... TruSeq SBS Kit v3-HS 50 cycles kit (Illumina).
-
bioRxiv - Genomics 2020Quote: Equimolar libraries from each 96 well plate were pools and sequenced with NextSeq500 (Illumina) High Output ...
-
bioRxiv - Cancer Biology 2023Quote: ... One barcoded library was prepared per plate using TD buffer and TDE1 enzyme (Illumina) for tagmentation and KAPA HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA-Seq libraries were generated from 1 μg of total RNA from duplicated samples per condition using the TruSeq LT RNA Library Preparation Kit v2 (Illumina) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: Total RNA (1 µg) from hASCs was used to construct sequencing libraries with the Truseq Stranded Total RNA LT Kit (Illumina). Quality of RNA and constructed libraries was determined via 2100 Bioanalyzer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10%(v/v) N,N-dimethyl formamide) and 1 μl of Tagment DNA Enzyme from Nextera Sample Preparation Kit (Illumina) were added to the DNA-beads complex and incubated for 70 sec at 37 °C ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were generated using Kapa Biosystems library preparation kit (#KK8201) and multiplexed libraries were sequenced on a 1×75 High output flow cell on the NextSeq550 platform (Illumina). Reads were filtered and trimmed to remove adapter-derived or low-quality bases using Trimmomatic and checked again with FASTQC ...
-
bioRxiv - Genomics 2020Quote: ... Other libraries were sequenced on NextSeq 500 (1x 28 / 1×91 cycles plus 8 base index cycle) using the v2 150 cycle High Output kit (Illumina) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: Libraries were prepared using 1 µg of total RNA in the randomized order using TruSeq RNA Sample Prep Kit v2 (Illumina) to generate cDNA as per manufacturer’s instructions using adapters from both Box A and Box B ...
-
bioRxiv - Cell Biology 2019Quote: A minimum of 1 µg total RNA in 50 µl was used for library preparation using the TruSeq RNA sample preparation kit (Illumina) following the manufacturer’s protocol at Novogene ...
-
bioRxiv - Genetics 2020Quote: ChIP-seq and DNase-seq libraries were prepared from 1-5 ng ChIP DNA or DNase DNA samples using NEBNext Ultra II DNA library Prep Kit (Illumina). Libraries were sequenced on an Illumina NextSeq 500 with single-end or paired-end 75 bp reads.
-
bioRxiv - Genomics 2019Quote: ... two different strategies were implemented in order to help in genome scaffolding: 1) Nextera Mate-Pair Preparation Kit (Illumina Inc) was used to make two mate pairs (MP ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of input RNA was used for rRNA removal with Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Libraries were generated with the NEBNext Ultra Directional RNA Library Prep kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries were prepared from 1 μg of total RNA using a TruSeq Stranded Total RNA Kit with Ribo-Zero Human/Mouse/Rat (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Amounts of 1 ng cDNA were used to prepare NGS sequencing libraries using Nextera XT DNA Library Prep Kit (Illumina), with unique index adaptors for each sample ...
-
bioRxiv - Immunology 2020Quote: ... cDNA libraries were prepared from 1 μg of total RNA using the TruSeq Stranded mRNA kit (Illumina, San Diego, CA) and the Sciclone NGSx Workstation (Perkin Elmer ...
-
bioRxiv - Genetics 2019Quote: DNA sequencing libraries were constructed from 1 µg of genomic DNA using TruSeq DNA PCR-free Library Prep kit (Illumina). Sequencing was run on an Illumina HiSeq 2500 apparatus using a paired-end read length of 2×150 pb with the Illumina Reagent Kits as already described (Demars et al ...
-
bioRxiv - Cancer Biology 2019Quote: WGS libraies were generated from 1 μg of 50 ng/ul high molecular weight gDNA using the TruSeq PCR-free Library Prep Kit (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 bases for index 1 and 8 bases for index 2) using the NextSeq 500 High Output Kit 75-cycles (#FC-404-1005, Illumina) loaded at 1.8pM and including 1 % PhiX ...
-
bioRxiv - Genomics 2022Quote: Library preparation from 1-10ng rRNA-depleted RNA was performed using NEBNext UltraII Directional RNA Library Preparation Kit (Illumina, #E7760) following the vendor protocols and complementing cleaning steps with NEBNext Sample Purification Beads (#E7767) ...
-
bioRxiv - Immunology 2020Quote: ... Use of 250 pg of cDNA with 1/5 reaction of Illumina Nextera XT kit (Illumina, San Diego, CA, USA). The length distribution of the cDNA libraries was monitored using DNA High Sensitivity Reagent Kit on the Perkin Elmer Labchip GX system (PerkinElmer ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were generated using Kapa Biosystems library preparation kit (#KK8201) and multiplexed libraries were sequenced on a 1×75 flow cell on the HiSeq2000 platform (Illumina). Reads were filtered and trimmed to remove adapter-derived or low-quality bases using Trimmomatic and checked again with FASTQC ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... A paired-end Illumina library (DRR029460; see also Supplementary File 1) was constructed using a TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) and an RNA sample extracted from an E ...
-
bioRxiv - Immunology 2022Quote: ... Small RNA libraries were prepared using 1 µg of total RNA and the TruSeq Small RNA Sample Prep Kits (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... then single-end sequenced (1 x 100 bp) on one lane using TrueSeq PE150 kit (Illumina, Inc., San Diego, CA) on an Illumina HiSeq 2000 instrument ...
-
bioRxiv - Cancer Biology 2020Quote: Sequencing was performed by the Human & Environmental Genomics core facility of Rennes on a HiSeq 1500 (Rapid SBS kit v2 1×100 cycles, Illumina). Base Calling was performed with Illumina’s CASAVA pipeline (Version 1.8).