Labshake search
Citations for Illumina :
1 - 50 of 297 citations for Dengue Virus Serotype 3 VLP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The virus sequence was confirmed by Illumina sequencing and did not differ from the parental virus ...
-
bioRxiv - Microbiology 2023Quote: ... and Respiratory Virus Oligo Panel v2 (Illumina #20044311). Tagmented cDNAs were amplified to add indexes and adapters ...
-
bioRxiv - Immunology 2021Quote: ... The identity of the virus was confirmed by Illumina sequencing (see supplementary table 1).
-
bioRxiv - Microbiology 2023Quote: ... Library preparation for VLP genomic DNA involved using >25ng input DNA with the Nextera DNA Flex Library Preparation Kit (currently named Illumina DNA prep, Illumina, CA, USA). Deviating from the Illumina protocol’s full reaction volume (50 µL) ...
-
bioRxiv - Genomics 2020Quote: ... Nextera Flex Enrichment Kit with Respiratory Virus Oligo Panel (Illumina Inc, USA) for viral RNA capture and sequencing ...
-
bioRxiv - Genomics 2020Quote: ... with the respiratory virus oligo panel including SARS-CoV-2 probes (Illumina, San Diego ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries from different virus isolates were pooled and sequenced on iSeq 100 (Illumina) with 2×75bp reads.
-
bioRxiv - Genomics 2020Quote: ... samples were enrichment with the Respiratory Virus Oligos Panel (Illumina, Catalog no. 20042472), which features ∼7800 probes designed to detect respiratory viruses ...
-
bioRxiv - Immunology 2021Quote: Virus stocks were sequenced using a MiniSeq platform (Illumina, Inc; San Diego, CA, USA). In brief ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... The virus was passaged three times in VeroE6 cells and genotype sequence confirmed by Illumina sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The stability of the virus genotype after passage was confirmed via Sanger sequencing and by Illumina sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Microbiology 2020Quote: ... At Gdansk two independent protocols were used for SARS-CoV-2 genome sequencing: Illumina RNA prep with enrichment for respiratory virus oligos panel V2 followed by Illumina MiniSeq medium output run that produced 150-nucleotide paired-end reads ...
-
bioRxiv - Immunology 2022Quote: Identity of virus stocks were confirmed by next-generation sequencing using a MiniSeq platform (Illumina, Inc; San Diego, CA, USA). RNA was purified from Trizol-inactivated material using a Direct-zol RNA Miniprep kit (Zymo Research ...
-
bioRxiv - Pathology 2020Quote: Library preparation for NHBE samples infected with influenza A virus (IAV) was performed using the TruSeq Stranded mRNA Library Prep Kit (Illumina) with Poly-A enrichment ...
-
bioRxiv - Microbiology 2022Quote: ... Passage 1 virus stocks were further produced in Vero TMPRSS2 cells and the presence of mutations was confirmed by Illumina sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were generated for three separate plants for each virus Libraries were sequenced (single-end, 75 nt) using an NextSeq 500 platform (Illumina).
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genomics 2021Quote: ... DNA fragments of the SARS CoV-2 genome were hybridized with biotinylated respiratory virus oligos (Illumina Inc., San Diego, CA, USA). The DNA fragments hybridized with the custom oligos were captured using streptavidin magnetic beads ...
-
bioRxiv - Microbiology 2023Quote: The whole genome sequence of the mink-derived H5N1 clade 2.3.4.4b virus was determined using the Illumina MiSeq sequencing platform (Illumina, San Diego, CA, USA). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from Epstein–Barr-virus-transformed lymphoblastoid cell lines (LCLs) by following the Illumina TruSeq v2 RNA Sample Preparation protocol (Illumina, Inc., San Diego, CA) by the Department of Genetic Medicine and Development at the University of Geneva ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...