Labshake search
Citations for Illumina :
1 - 50 of 1066 citations for Dendritic Cell Specific Transmembrane Protein DCSTAMP Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... sample specific barcodes (Illumina Nextera) were introduced ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and prepared strand-specific libraries with the TruSeq strand-specific Total RNA kit (Illumina Inc.), which was sequenced on the NextSeq 500 system to obtain 50 million 100bp paired end reads ...
-
bioRxiv - Neuroscience 2024Quote: ... 3.5ug cDNA was biotin labeled (Nugen Illumina) 1.5ug of cDNA was hybridized to the Illumina Mouse WG-6 V2.0 BeadChip containing 45821 probes ...
-
bioRxiv - Systems Biology 2022Quote: ... we sorted 500-1000 clonally expanded HLA-A2/YFV NS4b-specific CD8+ T cells directly into 22.5μl of ATAC-buffer (12.5μl 2× TD Buffer (Illumina), 0.5μl 1% Digitonin (Promega G9441) ...
-
bioRxiv - Neuroscience 2024Quote: ... Strand-specific RNA sequencing was performed by Maryland Genomics in NovaSeq S4 flow cells (NovaSeq6000, Illumina) at 100bp paired end reads with 67 ± 18 million (mean ± SD ...
-
bioRxiv - Molecular Biology 2024Quote: ... QHR-4C libraries were constructed with specific primer pairs (forward primers containing Illumina P5 with sequences near a specific viewpoint and reverse primers containing Illumina P7 with an index and sequences matching the adapter ...
-
bioRxiv - Immunology 2021Quote: ... 2μL of 10μM RPI library specific primer (Illumina) and 1.3μL water using the following thermocycling conditions ...
-
bioRxiv - Immunology 2021Quote: ... 2μL of 10μM RPI library specific primer (Illumina) and 1.3μL water using the following thermocycling conditions ...
-
PD-1 checkpoint blockade disrupts CD4 T cell regulated adaptive B cell tolerance to foreign antigensbioRxiv - Immunology 2021Quote: ... 2μL of 10μM RPI library specific primer (Illumina) and 1.3μL water using the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 sets of class-specific IGH and lGK/L constant region gene-specific reverse primers (with second-round primers including Illumina Read2 sequence). Primer sequences are listed in Supplementary table S7 ...
-
bioRxiv - Microbiology 2020Quote: ... specific sequencing Nextera XT v2 Index Kit adapters (Illumina) were annealed to the amplicons via Index PCR (Table S2 ...
-
bioRxiv - Microbiology 2022Quote: ... but tagged with specific adapters (Illumina, San Diego, USA). Each reaction mixture contained 12.5 µl Kapa HiFi HotStart ReadyMix (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The biotin-labeled fragments were further enriched and sequenced by Illumina Novaseq ...
-
bioRxiv - Plant Biology 2022Quote: ... True-Seq strand specific libraries (Illumina, San Diego, CA, USA) were multiplexed and sequenced on an Illumina HiSeq4000 platform to generate >15 million 50-nucleotide single-end reads per sample.
-
bioRxiv - Genomics 2020Quote: ... Following sequencing of strand-specific libraries on a HiSeq4000 platform (Illumina), raw reads were mapped to the human reference genome (hg19) ...
-
bioRxiv - Neuroscience 2021Quote: ... Strand-specific DNA libraries were prepared with Illumina TruSeq Kit (Illumina) and sequenced using the Illumina sequencing platform24 ...
-
bioRxiv - Neuroscience 2020Quote: ... the Nextera indices (12 pool-specific indices, Illumina, FC-131-2001) and 10 µM P5-TSO hybrid primer (5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCA ACGCAGAGT*A*C-3’ ...
-
bioRxiv - Genomics 2020Quote: ... Following standard strand-specific cDNA library preparation using the TruSeq kit (Illumina), sequencing was performed on a NovaSeq6000 platform (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Fragments were amplified with 12–18 cycles using adaptor specific primers (Illumina); fragments ranging between 300 and 500⍰bp in size were gel-purified before cluster generation and sequencing ...
-
bioRxiv - Genetics 2021Quote: ... target-specific oligos combined with Ribo-Zero rRNA removal kit (Illumina, USA). After purification ...
-
bioRxiv - Cancer Biology 2020Quote: ... The strand specific RNA library prepared using TruSeq stranded mRNA kit (Illumina). Libraries were quality checked and sized with a TapeStation 4200 (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... with short-read strand-specific library prep with poly A enrichment (Illumina). Paired-end reads were filtered to remove low-quality reads (Q ≤5 ...
-
bioRxiv - Biochemistry 2024Quote: Sequencing of strand-specific libraries was performed on a NextSeq2000 sequencer (Illumina) to obtain 65 bases single-end reads ...
-
bioRxiv - Plant Biology 2020Quote: ... Strand-specific libraries were prepared using the TruSeq Stranded Total RNA kit (Illumina). PolyA+ RNAs were selected according to manufacturer’s instructions and the cDNA libraries were sequenced on a HiSeq 2500 Illumina sequencer ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were prepared using the TruSeq strand-specific mRNA sample preparation system (Illumina). The final library was generated by further purification and amplification with PCR ...
-
bioRxiv - Genomics 2020Quote: ... libraries were normalized on specific beads according to the Nextera XT protocol (Illumina). Normalized libraries were pooled into a single library for sequencing on MiSeq ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... fusion primers (i.e. containing partial adapters sequences specific of respectively Illumina or ONT) were used for the first PCR ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries of strand-specific paired-end reads were sequenced by Illumina HiSeq 2000 ...
-
bioRxiv - Genetics 2020Quote: ... Genes found to be L5-specific (present in completed PacBio and Illumina genomes) were also checked for SNPs in these genes using each of the L5 completed PacBio genomes as a reference ...
-
bioRxiv - Molecular Biology 2020Quote: RNA (2.5 μg) was processed using rRNA depletion beads specific to yeast (Illumina). Bar-coded sequencing libraries were prepared as recommended by the manufacturer (TruSeq Stranded Total RNA Library Preparation Kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... QHR-4C libraries were constructed with specific primer pairs (forward primers containing Illumina P5 with sequences near a specific viewpoint and reverse primers containing Illumina P7 with an index and sequences matching the adapter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Strand-specific libraries were prepared using a TruSeq RNA Sample Preparation Kit (Illumina) and the dUTP method ...
-
bioRxiv - Developmental Biology 2023Quote: ... strand-specific sequencing platform was used on Illumina NextSeq 500 (Illumina, CA, USA) with a read length of 75 bp.
-
bioRxiv - Cell Biology 2023Quote: ... Individual libraries were pooled with specific index sequences and then sequenced by Illumina Next Seq 500 platform (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Tissue-specific libraries were sequenced PE150 on two lanes of NovaSeq 6000 (Illumina) (table S1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Strand-specific libraries were prepared using a TruSeq RNA Sample Preparation Kit (Illumina) and the dUTP method ...
-
bioRxiv - Biochemistry 2024Quote: ... Strand-specific sequencing libraries were generated from rRNA-depleted (Illumina RS-122-2301) total-RNA samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cell surface protein libraries were sequenced on the NextSeq 550 System (Illumina).
-
bioRxiv - Genetics 2022Quote: ... RNA libraries were prepared using the Strand-Specific TruSeqTM RNA-Seq Library Prep (Illumina). Sequencing ...
-
bioRxiv - Genomics 2021Quote: ... with an average methylation value for a specific cytosine (present on Illumina 450K arrays) of less than 0.3 in the specific immune cell type and greater than 0.8 in over 90% of tissues and other immune cells ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene-specific primers were designed based upon sequences obtained from the sequenced transcriptome (Illumina) of D ...
-
bioRxiv - Immunology 2024Quote: ... Tumor-specific structural variants (SVs) were identified using the manta software (https://github.com/Illumina/manta/blob/mater/docs/userGuide/README.md#introduction).
-
bioRxiv - Microbiology 2022Quote: ... and strand-specific libraries were prepared with TruSeq Stranded mRNA Library Prep kit (Illumina). The resulting libraries were sequenced using a Novaseq flow cell (Fasteris ...
-
bioRxiv - Molecular Biology 2023Quote: ... Raw sequence reads were demultiplexed into sample-specific fastq files (bcl2fastq program v2.20.0.422, Illumina). The resulting fastq files were processed as follows ...
-
bioRxiv - Genetics 2024Quote: ... Sample specific genotypes for using with WASP were generated using Omni 2.5M arrays (Illumina) and imputed using the Michigan Imputation Server92,93 (https://imputation.biodatacatalyst.nhlbi.nih.gov/) ...
-
bioRxiv - Genomics 2024Quote: In the specific case where the 10X adaptor sequence had been removed by Illumina’s trimming software ...
-
bioRxiv - Molecular Biology 2021Quote: ... strand-specific RNA libraries were generated with the TruSeq mRNA Stranded sample preparation kit (Illumina) starting from 1μg of RNA from each fraction (total and polysomal) ...
-
bioRxiv - Developmental Biology 2022Quote: We generated strand-specific RNA-seq libraries (using the Illumina TruSeq Stranded mRNA Library protocol) for a total of six samples obtained from whole embryos incubated at 26°C (four samples ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by the preparation of strand-specific cDNA libraries with the Illumina TruSeq kit (Illumina) and deep sequencing using the Illumina sequencing platform as previously described19,51,52 ...