Labshake search
Citations for Illumina :
1 - 50 of 552 citations for DIRAS Family GTP Binding RAS Like 1 DIRAS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... A genome-wide analysis genotyping scan was performed in all six members of family A and in the proband of family B using the HumanCytoSNP-12 DNA Analysis BeadChip Kit (Illumina, San Diego), according to manufacturer’s instruction ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The chromatogram files generated by NGS platforms (like Illumina HiSeq TM 2000, MiSeq) are transformed by CASAVA Base Calling into sequencing reads ...
-
bioRxiv - Genomics 2019Quote: ... For HapMap samples and three PGT-M families paired-end (2×125bp) sequencing was performed on a HiSeq2500 system (Illumina) in multiple runs ...
-
bioRxiv - Microbiology 2020Quote: ... The number of exported cells was estimated on family-level by first multiplying 16S rRNA gene abundances per liter by the seepage volume collected at a given time point and by the relative abundance of a given family obtained from Illumina amplicon sequencing ...
-
bioRxiv - Genetics 2023Quote: ... The IBD between long-lived family members was calculated using the --ibd module from Merlin using previously generated genome-wide genetic data from Illumina BeadChips 72.
-
bioRxiv - Molecular Biology 2023Quote: ... If we add a task (like the pre-demultiplexing paired-end raw fastq file merge for Illumina), we only need to adjust the orchestration function’s code to incorporate this new step.
-
bioRxiv - Developmental Biology 2021Quote: ... libraries were also prepared using 50 ng of gDNA isolated from NaR P5 and 3D-RA DD25 cells by following the Nextera DNA Sample Preparation Guide (Illumina). The libraries were purified using the MinElute PCR purification kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and g2997a) at the forward primer binding site used in the ‘round 1 PCR’ step below (the step attaching partial Illumina sequencing adaptors), thus excluding PCR amplification of the competitor viruses during sequencing library preparation such that only the library viruses ...
-
bioRxiv - Molecular Biology 2020Quote: ... The forward primer included a P5 sequence (for binding the Illumina flow cell) followed by a Illumina sequencing primer binding site ...
-
bioRxiv - Molecular Biology 2020Quote: ... the reverse primer included a P7 sequence (for binding the Illumina flow cell) followed by a 6-nt i7-index sequence ...
-
bioRxiv - Genomics 2021Quote: ... reporter cDNA was PCR amplified using a reporter specific forward primer and a reverse primer binding the anchor sequence of the oligo- dT primer (corresponding to the Illumina TruSeq Read 1 sequence):
-
bioRxiv - Neuroscience 2022Quote: ... reverse-transcribed using random hexamer primers that introduce Truseq Small RNA kit RP1 primer binding sites (Illumina) and finally converted into DNA libraries using custom rpi primers (RNA PCR Primer Index ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... second BsmBI site (producing cut-edge between the base pairing region and dCas9 handle binding region) and read2 (Illumina sequencing element) was amplified from pPEPZ-sgRNAclone (Addgene# 141090 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Extracted DNA was PCR amplified with a forward primer binding to the end of the leader sequence (PCR1 Fwd primer with Illumina adapter overhang) and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang) ...
-
bioRxiv - Genomics 2023Quote: ... All libraries were pooled and subjected to paired-end 75 bp sequencing (paired- end 76 nt reads with the first 1 nt of Read 1 and the last 1 nt of Read 2 trimmed) using the NextSeq500 system (Illumina, CA, USA). For each library ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of forward and 1 μl of reverse 25 μM PCR primers (Illumina), and 0.5 μl of Phusion high-fidelity DNA polymerase (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... collected with the magnet and resuspended in 24ul of Tagmentation Mix (1:1 Illumina 2× Tagmentation buffer ...
-
bioRxiv - Genetics 2019Quote: ... 1% PhyX spike-in (Illumina) was included ...
-
bioRxiv - Immunology 2021Quote: ... Group 1 (The Netherlands, Illumina), Group 2 (France ...
-
bioRxiv - Microbiology 2021Quote: ... 1×75 cycles (Illumina, USA). Image analysis was performed in real time by the NextSeq Control Software and Real Time Analysis running on the instrument computer ...
-
bioRxiv - Systems Biology 2022Quote: ... 1% PhyX spike-in (Illumina) was added then pooled ...
-
bioRxiv - Genomics 2024Quote: ... Miniaturization involved testing libraries at 1/6th (IDT mini) or 1/8th (Roche mini, Illumina mini) of reaction volume tailoring input DNA to each kit between 24-45 ng total (Table 2) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μtagment DNA enzyme (Nextera, Illumina), l nuclease free water ...
-
bioRxiv - Genetics 2019Quote: ... supplemented with 1 μl Tn5 (Illumina). Samples were then reverse cross-linked using the iDeal® ChIP-seq kit for histones according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 1 μl of transposase (Nextera, Illumina) was added and samples were incubated at 37°C for 10 minutes followed by two washes with low-salt buffer ...
-
bioRxiv - Immunology 2020Quote: ... cells were lysed in lysis buffer for 1 minute and transposed with Tagment DNA Enzyme 1 (Illumina) for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: Single-cell antibody repertoire libraries were sequenced on an Illumina NovaSeq 6000 system (Illumina RTA Version: V3.4.4) using a 26 x 91 bp read configuration.
-
bioRxiv - Genetics 2020Quote: ... using a bead-to-DNA ratio of 1:1 before high-throughput sequencing on the MiniSeq system (Illumina). Libraries were sequenced 1 × 75bp for a minimum coverage of 2 million read depth ...
-
bioRxiv - Genomics 2022Quote: ... Consensus LADs (between the Nanopore-DamID undiluted and 1:1/10 dilution and between the two Illumina replicates) were determined using intersectBed.
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Genomics 2021Quote: ... 0.4 µM oligo 1 (a truncated Illumina read 1 sequence followed by six random bases ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Read 1 sequence (excluding Illumina barcodes) was aligned to a short reference sequence of AAV9:
-
bioRxiv - Synthetic Biology 2022Quote: ... The Read 1 sequence (excluding Illumina barcodes) was aligned to a short reference sequence of AAV9 ...
-
bioRxiv - Genomics 2021Quote: ... at a 1:1 ratio and constructed into sequencing libraries using TruSeq DNA Preparation Kit (Illumina Inc, California, US). Sequencing was carried out using Illumina MiSeq paired-end 2 × 300 bp and performed by the High-Throughput Sequencing Core Facility in Biodiversity Research Center in Academia Sinica.
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCT TG, Illumina TruSeq Adapter Read 2 ...
-
bioRxiv - Microbiology 2021Quote: ... The purified PCR products were then processed and sequenced using the NextSeq 75 – High Output (82 cycles in read 1, 8 cycles in index 1, and 8 cycles in index 2 SE reads) (Illumina). The sequencing data was analyzed using the Model-Based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK ...
-
bioRxiv - Developmental Biology 2020Quote: ... assays for size distribution and concentration prior to pooling the multiplexed libraries for single-end 1×51nt or 1×75 sequencing on the HiSeq 2500 or HiSeq 4000 System (Illumina). Libraries were sequenced to a depth of >20M uniquely aligned reads.
-
bioRxiv - Plant Biology 2020Quote: ... A total of 56 samples (Appendix 1) were sequenced together on one lane of 1×75bp NextSeq500 High Output (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... using single end 63bp for Read 1 and 12bp for index 1 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... using single end 75bp for Read 1 and 8bp for index 1 and 8bp for Index 2 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... Sequence data were first converted into fastq format using bcl2fastq v2.17.1.14 with the following parameters --use-bases-mask=Y150,I13,I12,Y150 --minimum-trimmed-read-length=1 --mask-short-adapter-reads=1 --create-fastq-for-index-reads (Illumina).
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were run on an Illumina Nextseq 550 instrument using the MetSeq Primer 1 (NuGEN) mixed with the Read 1 primer (Illumina) according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... and 1 µl of Nextera Tn5 enzyme (Illumina) on ice and incubated at 55°C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 12 assemblies were done: 1) baseline (Illumina only), 2 ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL 12.5 μM Nextera Ad1 primer (Illumina), 1 μL 12.5 μM Nextera Ad2 barcoded primer (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 µL of amplicon tagmentation mix (Illumina) in a final volume of 10 µL and incubated at 55 °C for 7 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Read 1 was read with primer HP6 (Illumina) with 3 dark cycles (first 3 bases of read 1 were not read) ...