Labshake search
Citations for Illumina :
1 - 50 of 8948 citations for DHEA S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... modified universal primers S-D-Bact-0909-a-S-18 and S-*-Univ-*- 1392-a-A-15 (ref.46) and Nextera XT Index Kit V2 (Illumina) were used along with Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... Initial processing of raw sequencing data was managed by Illumina’s software (Illumina, CA, U.S.A). Sample deconvolution was conducted with one mismatch allowed in primers and zero mismatches in barcodes ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... according to manufacturer”s instructions and sequenced using a 2 × 250-cycle MiSeq Reagent kit v3.0 (Illumina, CA).
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... The isolated DNA samples were sent to the Center for Applied Genomics at the Children’s Hospital of Philadelphia for the SNP array analysis using the Infinium Global Screening Array-24 v3.0 Kit (Illumina). The chromosome copy number analysis was performed as described previously22 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The isolated DNA samples were sent to the Center for Applied Genomics at the Children’s Hospital of Philadelphia for the SNP array analysis using the Infinium Global Screening Array-24 v3.0 Kit (Illumina), which enabled the sequencing of 759,993 SNPs across the genome ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5’ Illumina adapter (used in the Illumina small RNA kit) and a T7 promoter) ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was prepared into equimolar pools for each sample submitted to Indiana University’s Center for Genomics and Bioinformatics for cDNA library construction using a TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) following the standard manufacturing protocol ...
-
bioRxiv - Microbiology 2019Quote: ... was submitted to Indiana University’s Center for Genomics and Bioinformatics for cDNA library construction using a TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Plate-based RNA sample prep was performed on the PerkinElmer Sciclone NGS robotic liquid handling system using Illumina’s TruSeq Stranded mRNA HT sample prep kit utilizing poly-A selection of mRNA following the protocol outlined by Illumina in their user guide ...
-
bioRxiv - Plant Biology 2022Quote: ... Plate-based RNA sample prep was performed on the PerkinElmer Sciclone NGS robotic liquid handling system using Illumina’s TruSeq Stranded mRNA HT sample prep kit utilizing poly-A selection of mRNA following the protocol outlined by Illumina in their user guide ...
-
bioRxiv - Genomics 2021Quote: Plate-based RNA sample prep was performed on the PerkinElmer Sciclone NGS robotic liquid handling system using Illumina’s TruSeq Stranded mRNA HT sample prep kit utilizing poly-A selection of mRNA following the protocol outlined by Illumina in their user guide (https://support.illumina.com/sequencing/sequencing_kits/truseq-stranded-mrna.html ...
-
bioRxiv - Plant Biology 2023Quote: ... Plate-based RNA sample preparation was performed on the PerkinElmer Sciclone NGS robotic liquid handling system using Illumina’s TruSeq Stranded mRNA HT sample prep kit utilizing poly-A selection of mRNA following the protocol outlined by Illumina in their user guide ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR was performed for 40 cycles (15 s at 95°C and 45 s at 60°C) using a Thunderbird SYBR Green Polymerase Kit (TOYOBO) and Eco Real-Time PCR System (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of transposase enzyme (Illumina Tagment DNA TDE1 kit, 20034197). We also included additional components ...
-
bioRxiv - Microbiology 2021Quote: Short-read paired-end sequencing of DNA and rRNA-depleted samples was performed on the Illumina Novaseq platform (S prime, 2x 150 bp) using TruSeq PCR free DNA library preparation kit (Illumina Inc.).
-
bioRxiv - Molecular Biology 2019Quote: ... the 5’ Illumina adapter (as used in the Illumina small RNA kit), a 3 nt UMI (unique molecular identifier) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the 5’ Illumina adapter (as used in the Illumina small RNA kit) and a T7 promoter ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 plates of mRNA libraries were sequenced using the Nextseq550 high output kit (Illumina) with 35 paired-end reads according to the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Immunology 2019Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
bioRxiv - Immunology 2021Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
bioRxiv - Genomics 2023Quote: ... the 5’ Illumina adapter (as used in the Illumina TruSeq Small RNA kit) and a split 2x 3 nt Unique Molecular Identifier (UMI ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genomics 2023Quote: A 96-well plate pre-loaded with 5 μl of 500 nM pre-indexed Tn5 transposase per well (iTSM plate, kind gift of Illumina Inc.) was used to multiplex samples and perform barcoded transposition ...
-
bioRxiv - Immunology 2022Quote: ... A total of 250ng total RNA was used for each sample as input to the TruSeq Stranded Total RNA library prep kit with unique-dual indexing (catalog #s 20020598 & 2002371; Illumina, San Diego, CA, USA). Libraries were assessed for mass using the Qubit 1X dsDNA HS Assay kit (catalog # Q33231 ...
-
bioRxiv - Genomics 2021Quote: ... libraries with an average insert size of 450 bp were prepared by the University of Utah’s Huntsman Cancer Institute High-Throughput Genomics Core Facility using the Illumina TruSeq DNA PCR-Free Library Prep Kit (Illumina, San Diego, California, USA). 2 × 150 bp reads for each parent were generated on an Illumina NovaSeq 6000 instrument using the NovaSeq S2 reagent kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µg of total cellular RNA was depleted of ribosomal RNA (RiboZero kit, Illumina), and subjected to base hydrolysis ...
-
bioRxiv - Genetics 2021Quote: ... A receptacle 96 well plate was prepared with 9uL 1X TD buffer (Nextera XT Kit, Illumina Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... this new plate was used for library preparation (Nextera XT kit; Illumina, Cat#: FC-131–1096) using a semi-automated pipeline ...
-
bioRxiv - Developmental Biology 2022Quote: ... Libraries were sequenced on a NovaSeq 6000 S Prime flowcell (Illumina) as paired-end 28 + 94 nucleotide reads ...
-
bioRxiv - Cell Biology 2022Quote: ... Tagmentation products were amplified by PCR by adding 1.25 µl of each N and S primers (Illumina Nextera XT 96-index kit FC-131- 1002) and 3.75 µl of NPM solution and using the following thermocycler settings ...
-
bioRxiv - Microbiology 2024Quote: Extracted DNA and cDNA were submitted to Georgia Institute of Technology’s Molecular Evolution Core where for sequencing using the Illumina MiSeq v3 kit PE300 using Illumina Nextera Adapter Sequences (Illumina Inc, San Diego, California, USA). The samples were demultiplexed and barcodes removed by the sequencing core ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Genomics 2020Quote: ... The harvested single-cell cDNA was barcoded in 96 well plate using Nextera XT Library Prep kit (Illumina). Uniquely barcoded libraries from single-cells pooled together and sequenced using a HiSeq-Hi-output-2500 sequencer (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... along with number of cells loaded onto each plate was optimized for S1 and S2 100 cycle kits (Illumina) with the configuration of 67×8×50 bp ...
-
bioRxiv - Immunology 2020Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A-D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Dual-barcoded libraries were pooled and sequenced using Illumina Nextseq 550 platform ...
-
bioRxiv - Cell Biology 2021Quote: ... The purified DNA was PCR amplified for 5 cycles using a Nextera DNA Library Index kit (Illumina) and Phusion HF Master Mix (New England BioLabs ...
-
bioRxiv - Plant Biology 2023Quote: ... Sequencing was performed with Illumina NovaSeq 6000 according to the manufacturer”s instructions (Illumina). The sequencing data are available at the NCBI Gene Expression Omnibus repository under accession number .
-
bioRxiv - Immunology 2020Quote: ... cDNA was harvested and diluted to 0.1–0.3 ng/μl and libraries were prepared in 96-well plates using a Nextera XT DNA Sample Preparation kit (Illumina) according to the protocol supplied by Fluidigm ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries were prepared using the Nextera XT DNA library preparation kit and combinations of IDT index plates (Illumina, USA). The final libraries were cleaned through AMPure SPRI bead (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified using the KAPPA quantification kit following manufacturers protocol after which the plates were sequenced on the NextSeq 500 (Illumina) for 25 million reads per plate.
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified using the KAPPA quantification kit following manufacturers protocol after which the plates were sequenced on the NextSeq 500 (Illumina) for 30 million reads per plate.