Labshake search
Citations for Illumina :
1 - 50 of 370 citations for D Ribitol 5 Phosphate Cytidylyltransferase ISPD CRPPA Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... The 5’ expression library and the V(D)J library were sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865).
-
bioRxiv - Microbiology 2023Quote: ... C and D (Illumina). Amplicon concentration across samples was normalized to 200 ng/μl using the Qubit high sensitivity dsDNA assay before pooling ...
-
bioRxiv - Cell Biology 2020Quote: ... and D (v.2, Illumina) and sequenced on HiSeq4000 and NovaSeq6000 (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Set D (Illumina, San Diego, USA). The sequences of the four sets of primers used during library preparation (limited cycle PCR ...
-
bioRxiv - Microbiology 2023Quote: ... Revision D (Illumina, San Diego, CA) beginning with the Repair Ends step (q.s ...
-
bioRxiv - Microbiology 2021Quote: ... B and D (Illumina, San Diego, CA). With a final reaction volume of 50 μL ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Nextera XT index kit D (Illumina). Amplicon sizes were verified on a Tapestation using the High Sensitivity D1000 Screentape (Agilent) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The index sequences were defined by the combination of primers with TruSeq HT index 1 (D 7xx) and TruSeq HT index 2 (D 5xx) (Illumina). Index PCR was performed using KAPA HiFi HS ReadyMix (Kapa Biosystems ...
-
bioRxiv - Systems Biology 2024Quote: ... 5’ amine-modified DNA oligonucleotides (5’-[AmC6]dUdUdUdUd-[Illumina_adaptor]-[spatial barcode]-[UMI]-[20T]-VN ...
-
bioRxiv - Pathology 2024Quote: ... aphidicola (C, D) based on SNPs identified from Illumina sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... The sorted cells were then washed with phosphate buffered saline (PBS) and resuspended in 50ul TD buffer (Illumina) with 0.01% digitonin and 2.5ul TDE Tagmentation enzyme (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... The Nextera XT Index Kit v2 Sets A-D (Illumina) barcodes were used for the amplified sequencing libraries and the quality of libraries was assessed using a Qubit fluorometer (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genomics 2024Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Neuroscience 2020Quote: ... Sample indexing was performed using index sets A and D (Illumina). At this point ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Microbiology 2023Quote: ... Barcodes of the Illumina NexteraTM DNA UD index set A-D (Illumina) were diluted 1:5 prior to the library amplification ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% PhiX loading control (Illumina).
-
bioRxiv - Genomics 2024Quote: ... with 5% PhiX spike-in (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... with 5% PhiX library control (Illumina). Autosmal ranged from 23X to 29X ...
-
bioRxiv - Immunology 2020Quote: ... Single-cell TCR V(D)J libraries were sequenced with HiSeq2500 machine (Illumina). All sequencing was done according to the manufacturer’s specification (10X Genomics).
-
bioRxiv - Cancer Biology 2023Quote: ... and V(D)J-enriched libraries were sequenced on a NextSeq 550 (Illumina).
-
bioRxiv - Genomics 2024Quote: ... using IDT for Illumina – Nextera DNA UD Indexes Sets A-D (Illumina, USA). Fragmentation times and amplification cycles were performed according to the ranges recommended by the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biochemistry 2024Quote: ... with 5% phiX (Illumina, FC-110-3001) was loaded to the sequencer ...
-
bioRxiv - Immunology 2022Quote: ... and BCR enriched V(D)J libraries were sequenced either on a Nextseq500 (Illumina) using a high output 150 cycle flowcell ...
-
bioRxiv - Microbiology 2023Quote: ... and IDT® for Illumina® DNA/RNA UD Indexes Set D (Illumina #20042667). Concentrations of 1.8 × AMPure XP magnetic bead purified libraries were measured using Qubit™ 1× dsDNA High Sensitivity Assay Kit (Thermo #Q33231 ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... Both gene expression and V(D)J libraries were sequenced on a Novaseq S4 (Illumina), targeting a median sequencing depth of 50,000 and 5,000 read pairs per cell ...
-
bioRxiv - Systems Biology 2023Quote: ... Libraries for Study D were prepared with the Nextera XT Library Prep kit (Illumina, USA) and sequenced with a paired-end 2x150bp protocol on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... Both gene expression and V(D)J libraries were sequenced on a Novaseq S4 (Illumina), targeting a median sequencing depth of 50,000 and 5,000 read pairs per cell ...