Labshake search
Citations for Illumina :
1 - 50 of 9015 citations for Cow Polypyrimidine tract binding protein 1 PTBP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... and cows were genotyped with the BovineSNP50 Beadchip (Illumina Inc). The genotype data for CattleGTEx animals were generated previously 4 and included a total of more than 6 million sequence variants imputed also using Run7 of the 1000 Bull Genomes Project ...
-
bioRxiv - Genomics 2022Quote: ... and cows were genotyped with the BovineSNP50 Beadchip (Illumina Inc). The genotype data for CattleGTEx animals were generated previously 14 and included a total of more than 6 million sequence variants imputed also using Run7 of the 1000 Bull Genomes Project ...
-
bioRxiv - Genetics 2021Quote: ... 371 cows were genotyped with BovineSNP50 v.2.0 array (Illumina Ca. USA). In the first quality control step ...
-
bioRxiv - Genetics 2019Quote: ... and 2,550 Tropical Composite (TC) cows and bulls genotyped using either the BovineSNP50 (Matukumalli et al. 2009)) or the BovineHD (Illumina Inc., San Diego, CA) that includes more than 770,000 SNP ...
-
bioRxiv - Neuroscience 2022Quote: ... reverse-transcribed using random hexamer primers that introduce Truseq Small RNA kit RP1 primer binding sites (Illumina) and finally converted into DNA libraries using custom rpi primers (RNA PCR Primer Index ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and g2997a) at the forward primer binding site used in the ‘round 1 PCR’ step below (the step attaching partial Illumina sequencing adaptors), thus excluding PCR amplification of the competitor viruses during sequencing library preparation such that only the library viruses ...
-
bioRxiv - Molecular Biology 2020Quote: ... The forward primer included a P5 sequence (for binding the Illumina flow cell) followed by a Illumina sequencing primer binding site ...
-
bioRxiv - Molecular Biology 2020Quote: ... the reverse primer included a P7 sequence (for binding the Illumina flow cell) followed by a 6-nt i7-index sequence ...
-
bioRxiv - Genomics 2021Quote: ... reporter cDNA was PCR amplified using a reporter specific forward primer and a reverse primer binding the anchor sequence of the oligo- dT primer (corresponding to the Illumina TruSeq Read 1 sequence):
-
bioRxiv - Cancer Biology 2022Quote: ... ScRNA-seq libraries were prepared using the Next GEM Chromium single cell 3′ reagent kits V3.1 with feature barcode technology for cell surface protein (10x genomics) and sequenced using NextSeq 500 high output kits and Novaseq S4 PE100 kits (Illumina). scRNA-Seq data after standard quality control was aligned to the reference genome (mm10 ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... Gene expression and surface protein libraries were generated using the Chromium Next GEM Single Cell 3 ’Reagent Kits v3.1 and sequenced by Illumina MiSeq or NextSeq2000 ...
-
bioRxiv - Microbiology 2022Quote: ... and libraries prepared using the NexteraXT kit and sequenced using HiSeq 1 × 150-cycle v3 kit (Illumina). The operational taxonomic unit (OTU ...
-
bioRxiv - Microbiology 2023Quote: ... second BsmBI site (producing cut-edge between the base pairing region and dCas9 handle binding region) and read2 (Illumina sequencing element) was amplified from pPEPZ-sgRNAclone (Addgene# 141090 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Extracted DNA was PCR amplified with a forward primer binding to the end of the leader sequence (PCR1 Fwd primer with Illumina adapter overhang) and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang) ...
-
bioRxiv - Cancer Biology 2020Quote: ... with MiSeq Reagent Kit V3 (150 cycle) (Illumina, MS-1-2-3001). The sequencing data was de-multiplexed and trimmed to contain only the sgRNA sequence cassettes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.003 μl Tagmentation DNA Enzyme 1 (TDE1; Illumina DNA sample preparation kit) to the 1μl of diluted cDNA per well ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA libraries were constructed from 1 μg/sample of total RNA using library preparation kits (NEBNext Ultra II RNA Library Prep Kit for Illumina 7770L ...
-
bioRxiv - Genomics 2021Quote: ... at a 1:1 ratio and constructed into sequencing libraries using TruSeq DNA Preparation Kit (Illumina Inc, California, US). Sequencing was carried out using Illumina MiSeq paired-end 2 × 300 bp and performed by the High-Throughput Sequencing Core Facility in Biodiversity Research Center in Academia Sinica.
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing libraries were constructed from 1 ng of pre-amplified cDNA using DNA library preparation kit (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme). Libraries were sequenced on a HiSeq-PE150 ...
-
bioRxiv - Genomics 2019Quote: ... and 1 uL of Tagment DNA enzyme (Nextera DNA sample preparation kit, Illumina), followed by incubation at 37°C for 30 minutes ...
-
bioRxiv - Genomics 2019Quote: ... Samples were sequenced on the NextSeq500 using the 1 × 75 v2 kit (Illumina) with 75 cycles and 305.06 × 106 reads passing filter were obtained across the 9 dilutions (2 replicates each ...
-
bioRxiv - Neuroscience 2022Quote: ... using single end 63bp for Read 1 and 12bp for index 1 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... using single end 75bp for Read 1 and 8bp for index 1 and 8bp for Index 2 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg RNA was rRNA-depleted using Ribo-Zero Gold rRNA removal kit (Illumina) then cleaned and purified using RNAClean XP Beads (Beckman Coulter) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Ribosomal RNA was depleted from 1 µg of total RNA using Ribozero (Illumina Kit). Sequencing libraries were prepared using the NEXTflex Rapid Directional RNA-Seq Kit ...
-
bioRxiv - Microbiology 2022Quote: ... 1 µg of RNA sample was rRNA-depleted using the RiboZero kit (Illumina, MRZB12424). Further library preparation of rRNA-depleted samples was performed using TruSeq Stranded mRNA library preparation kit (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA-Seq libraries were made from 1 µg total RNA per tissue sample using TruSeq stranded mRNA Library Prep Kit (Illumina, kit cat. no. 20020597) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... 1 μg of total RNA was used with the TruSeq RNA library preparation kit (Illumina) in accordance with the low-throughput protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries were prepared from 1 ug of RNA following TruSeq Stranded Total RNA kit (Illumina) with two technical replicates for each sample ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ng purified amplicons were processed with the Nextera XT DNA Library Preparation Kit (Illumina) and subsequently sequenced using the MiSeq reagent Kit v2 as described above.
-
bioRxiv - Cancer Biology 2020Quote: ... 1–2 mg of total RNA was used for Ribo-Zero rRNA Removal kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl of Nextera XT index primers 1 and 2 (Nextera XT Index kit, Illumina) and 2.5 μl of templated DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... ∼1 µg of RNA was used to construct libraries with Truseq Stranded mRNA kit (Illumina) and barcoded with IDT for Illumina-TruSeq DNA and RNA UD Indexes ...
-
bioRxiv - Immunology 2021Quote: ... and 1 ng was further used for library preparation using the Nextera XT LibraryPrep kit (Illumina). Tagmented DNA was amplified with a 12 cycle PCR reaction and again purified with AmpureXP beads ...
-
bioRxiv - Genomics 2020Quote: ... 10% dimethylformamide) and 1 μl Tagment DNA Enzyme from the Nextera DNA Sample Prep Kit (Illumina) and incubated at 37°C for 1 min in a thermocycler ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA libraries were prepared from 1 ug RNA (TruSeq Stranded Total RNA Library Prep Kit, Illumina) and 100 bp ...
-
bioRxiv - Microbiology 2021Quote: Total dsDNA (1 ng) was processed for WGS using the Nextera XT DNA library kit (Illumina) and performed on the Hamilton NGSStar (Hamilton Robotics) ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA libraries were prepared from 1 ug RNA (TruSeq Stranded Total RNA Library Prep Kit, Illumina) and 100 bp ...
-
bioRxiv - Microbiology 2021Quote: ... 1 ng of genomic DNA was processed using the Nextera XT DNA Sample Preparation Kit (Illumina). Next ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg of total RNA was then used in the TruSeq Stranded mRNA Library kit (Illumina). Libraries were sequenced on Illumina NextSeq 500 as paired-end 42-nt reads ...
-
bioRxiv - Immunology 2019Quote: ... and 1–10 ng were used to add Illumina Index with the Nextera XT kit (Illumina). After a final purification with Ampure XP beads (ratio 1:1) ...
-
bioRxiv - Immunology 2023Quote: ... 10% v/v dimethylformamide) containing 1 μl Tagment DNA Enzyme (Nextera DNA Sample Prep Kit (Illumina)) ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 μg of total RNA was processed with the TruSeq Stranded Total RNA LT Kit (Illumina) as follows ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in incorporation mix (MiSeq Nano kit v2 reagent 1) (Illumina MS-103-1003) for 5 minutes at 60 °C on a flat-top thermal cycler ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of RNA was used for library preparation with Truseq Stranded Total RNAseq kit (Illumina) with rRNA removal and sequenced on Illumina Novaseq 6000 (150 bp paired-end mode ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 µg of DNAse-treated RNA was treated with RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Microbiology 2020Quote: ... rRNA was removed from 1 μg of total RNA using Ribo-Zero(TM) rRNA Removal Kit (Illumina). Stranded cDNA libraries were generated using the Illumina Truseq Stranded mRNA Library Prep kit ...
-
bioRxiv - Genetics 2020Quote: ... Sequencing libraries were generated from total RNA (1 ug) using the TruSeq stranded mRNA kit (Illumina Corp.) and were sequenced using a NovaSeq6000 S4 ...
-
bioRxiv - Genomics 2020Quote: Paired-end sequencing libraries (Additional Table 1) were prepared using the TruSeq DNA Sample Prep kit (Illumina) according to the manufacturer’s instructions ...