Labshake search
Citations for Illumina :
501 - 550 of 9158 citations for Cortisol ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... The 5’gene expression libraries were sequenced in NextSeq or NovaSeq6000 sequencer (Illumina) using NextSeq 500/550 v2.5 sequencing reagent kit (read length ...
-
bioRxiv - Genomics 2019Quote: ... Each well was then mixed with 5 μL Nextera™ TD buffer (Illumina) and 1 μL i7 only TDE1 enzyme (25 nM ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... 5 µl nuclease and 2.5 µl Tn5 transposase enzyme (TDE1, Illumina, catalog # 15027865) and incubated for 28 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli transposition assays were mixed with 5 µL of tagmentation DNA buffer (Illumina) and 1 µL of amplicon tagmentation mix (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... with a loading sample concentration of 10pM and a 5% PhiX (Illumina, U.S.) spike-in ...
-
bioRxiv - Cell Biology 2020Quote: ... v2 Kit (Illumina Inc.). Illumina novaSeq base call (BCL ...
-
bioRxiv - Cell Biology 2019Quote: ... v2 Kit (Illumina Inc.). Approximately 44*106 reads were obtained for each sample ...
-
bioRxiv - Genomics 2019Quote: Three kits from Illumina were tested with different total RNA input ...
-
bioRxiv - Microbiology 2019Quote: ... Nextera XT kit (Illumina) was used for library preparation and 2 × 150 bp paired-end sequencing was conducted on a MiSeq platform (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... and SBS kits (Illumina). Target read depths were ∼5-10 million raw reads per sample.
-
bioRxiv - Microbiology 2019Quote: ... and index kit (Illumina). Library validation was performed on a 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Ligation kit (Illumina, Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... or nano kits (Illumina) depending of the DNA yield of the siolation process in any case using a more conservative 350bp insert size ...
-
bioRxiv - Cancer Biology 2023Quote: ... (M) Tagmentation Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Ligation kit (Illumina, Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Tagmentation Kit (Illumina, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... v2 Kit (Illumina Inc.), resulting in high-quality reads ranging from 11 to 17 million reads per sample (Table S3 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... ligation kit (Illumina, 20040532) according to the manufacturer’s instruction from 35 ng of RNA (except for macaque replicate_2 ...
-
bioRxiv - Genomics 2021Quote: ... Library preparation was carried out with the Nextera XT DNA Sample Preparation Kit and MiSeq Reagent Kit V2 Library Preparation Kit (Illumina Inc.). DNA was sequenced with Illumina MiSeq technology ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Plant Biology 2023Quote: ... from 100 to 1000 ng of total RNA using a stranded kit (Illumina TruSeq Stranded Total RNA Kit or NEB Next Ultra™ II Directional RNA Library Prep Kit for Illumina). The resulting data files contained paired end sequences (150 bp ...
-
bioRxiv - Bioengineering 2021Quote: ... using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) kit (Illumina). Sequencing was performed at the Genomics Research Unit ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the HiSeq 3000/4000 SBS Kit or TruSeq SBS Kit v4 (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... and Nextera XT DNA Library Preparation Kit and Nextera XT Index Kit (Illumina). Libraries were assessed using a High Sensitivity DNA Analysis Kit for the 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a TruSeq Kit mRNA Library Prep Kit (Illumina, San Diego, CA, USA) was used to prepare the strand-specific cDNA library for Illumina sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... with six hundred pg cDNA from each plate of cells used in a modified Nextera XT (Illumina) library preparation with 5 μM P5NEXTPT5 primer 42 ...
-
bioRxiv - Genomics 2020Quote: ... Next-Generation Sequencing were carried out using MiSeq Reagent Kit v3 or MiSeq Reagent Kit v2 Micro or Miseq reagent Kit v2 Nano in Miseq system (Illumina Inc, USA) or using NovaSeq 6000 SP Reagent Kit (Illumina Inc ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... with the « NEBNext® Ultra™ II DNA Library Prep Kit » kit (Illumina®). Paired-end sequencing was performed in on a HiSeq1500 (Illumina® ...
-
bioRxiv - Microbiology 2019Quote: ... machine with the NextSeq® 500 Mid Output Kit v2 kit (150 cycles) (Illumina), to generate read of 150 bp.
-
bioRxiv - Systems Biology 2023Quote: ... with a 300 bp paired-end reads sequencing kit (MiSeq Reagent Kit v3; Illumina). The raw data from the MiSeq instrument in the gz compressed FASTQ format were analyzed with several bioinformatics tools in the Linux operating system ...
-
bioRxiv - Microbiology 2023Quote: ... using the Illumina DNA Prep kit and unique dual indexes (Illumina Nextera Index kit) at 1:4 scale reaction volume ...
-
bioRxiv - Molecular Biology 2021Quote: ... (M) Tagmentation kit (Illumina, 20018705), with 6 cycles of amplification ...
-
bioRxiv - Genomics 2019Quote: ... and Mate-pair Kit (Illumina), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 500 cycle kit (Illumina, UK) at an 8 pM loading concentration with a 10 % PhiX spike-in ...
-
bioRxiv - Microbiology 2020Quote: ... and NexternaRTM Index Kit (Illumina). All cultured isolates (n=43 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... library preparation (Illumina TruSeq kit), and sequencing (Illumina Hi-Seq ...
-
bioRxiv - Physiology 2022Quote: TruSeq mRNA library kit (Illumina) was used to prepare the mRNA library following the manufacturer’s instructions ...