Labshake search
Citations for Illumina :
1 - 50 of 90 citations for Complement Factor B CFB Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... converted to the reverse-complement stranded Illumina sequencing library using the ScriptSeq Complete Kit (Bacteria, Illumina) and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre ...
-
bioRxiv - Microbiology 2022Quote: ... B provided by Illumina technical support ...
-
bioRxiv - Genomics 2021Quote: ... As it is not recommended to use the tandem complement barcodes on the Novaseq platform (Illumina tech support, pers. comm.), only 9,120 of the 9,216 possible barcode combinations can be used out of the barcode v0 design barcodes.
-
bioRxiv - Microbiology 2021Quote: ... 8) DC3000 − B (Illumina only), 9 ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Evolutionary Biology 2021Quote: Tn5ME-B (Illumina FC-121-1031), 59-GTCTCGTGGGCTCGGAGATGTGTA TAAGAGACAG-39
-
bioRxiv - Microbiology 2021Quote: ... B and D (Illumina, San Diego, CA). With a final reaction volume of 50 μL ...
-
bioRxiv - Genomics 2022Quote: ... Samples were pooled by volume using an index correction factor (from Illumina technical note “Balancing sample coverage for whole-genome sequencing and its associated index correction values”) ...
-
bioRxiv - Zoology 2020Quote: ... but with TruSeq DNA Single Indexes (Set B, Illumina), following the manufacturers’ instructions up till the adapter ligation step ...
-
bioRxiv - Systems Biology 2019Quote: ... Set B: indexes 13–24 (Illumina, RS-200-0024), Set C ...
-
bioRxiv - Cell Biology 2020Quote: ... and TruSeq RNA Single Indexes Set B (20020493, Illumina) according to standard Illumina library preparation procedure ...
-
bioRxiv - Cancer Biology 2019Quote: ... B with the TruSeq RNA Access Library Prep Kit (Illumina). RNA sequencing was performed in HiSeq 2500 (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... and TruSeq DNA Single Indexes Set A or B (Illumina), excluding the DNA fragmentation and clean-up of fragmented DNA steps ...
-
bioRxiv - Molecular Biology 2022Quote: ... and IDT Illumina RNA UD Indexes Set B (Illumina, Cat. 20040554). Libraries were sequenced on the NovaSeq at a depth of at least 25 million reads per sample in Paired End 100 mode ...
-
bioRxiv - Molecular Biology 2022Quote: ... and IDT Illumina RNA UD Indexes Set B (Illumina, Cat. 20040554). Libraries were sequenced on the NovasSeq at a depth of at least 50 million reads per sample in Paired End 100 mode ...
-
bioRxiv - Genomics 2020Quote: ... corresponds to the B-allele frequency estimated by Genome Studio (Illumina). When genotyping the tank milk by SWGS ...
-
bioRxiv - Plant Biology 2023Quote: ... and together with TruSeq DNA Sgl Index Set A/B (Illumina) to perform adapter ligation ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... (b) after index annealing with the Illumina indexing primer set (Illumina, #20020492), 12 PCR cycles were used for cDNA amplification ...
-
bioRxiv - Plant Biology 2023Quote: ... and together with Illumina TruSeq DNA sgl Index Set A/B (Illumina) to perform adapter ligation ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Nextera XT Index Kit v2 Set B (FC-131-2002, Illumina). 1.5 µl Nextera PCR Master Mix and 0.5 µl of a unique combination of primers were added to each well using the I.DOT and tagmented cDNA was amplified in a C1000 Thermal Cycler (72 °C for 3 min ...
-
bioRxiv - Microbiology 2024Quote: ... with the Nextera XT v2 Index Kit B (Illumina FC-131-2002) and then subsequently sequenced on an Illumina MiSeq instrument using a MiSeq Reagent kit v3 600 cycle (Illumina MS-102-3033 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TruSeq RNA Single Indexes Set A and B (Illumina, # 20020492 and 20020493). Library qualities and sizes were checked with the TapeStation 4200 and then quantified using the KAPA Library Quantification Kit for Illumina platforms (Kapa Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... The B-allele frequency and Log R ratio values were downloaded from Illumina GenomeStudio and processed and plotted using the GWASTools package in R (v3.6.1 ...
-
bioRxiv - Microbiology 2023Quote: ... with 6 nucleotides library indexes (DNA Single Indexes Set A or B, Illumina). To achieve sufficient variability during the first five sequencing cycles ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared using the TruSeq®Stranded mRNA LT Set B kit (Illumina) and sequenced (2×100bp ...
-
bioRxiv - Microbiology 2022Quote: ... according to the “16S Metagenomic Sequencing Library Preparation” protocol (Illumina, art #15044223 Rev. B). The quantity and quality of the cleaned amplicons were assessed using a Thermo Fisher Scientific Qubit 4.0 fluorometer with the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... using TruSeq SBS Kit v3 (cBot-HS) (Illumina, user guide; Part#15023333 Rev. B). The prepared libraries were enriched using 15 cycles of PCR and purified by the QIAquick PCR purification kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... with TruSeq RNA Single Indexes Set A and B (Illumina, Cat. No. 20020492 and 20020493). Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer (Agilent ...
-
bioRxiv - Immunology 2019Quote: ... The B-cell repertoire sequences consist of 150bp non-overlapping paired-end reads (Illumina MiSeq), with one read covering much of the V gene and the other read covering the area around the CDR3 region and the J gene ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 16S rRNA genes were amplified using the primers described below (Illumina Part #15044223 Rev. B) and sequenced using Sanger sequencing (Eton Biosciences ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and TruSeq RNA Single Indexes Sets A and B (Illumina Cat. No. 20020492 and 20020493). Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer (Agilent ...
-
bioRxiv - Plant Biology 2019Quote: ... Libraries were constructed using Illumina TruSeq RNA Single Indexes (Set A and B; Illumina, CA, USA) in a 14-cycle indexing PCR reaction ...
-
bioRxiv - Microbiology 2020Quote: ... B) Informatics benchmarking (‘Experiment 2’) in which a seawater virome was sequenced with short-reads (Illumina) and long-read sequencing ...
-
bioRxiv - Plant Biology 2020Quote: Illumina library preparation followed a modification of the Illumina 16S metagenomic protocol (Illumina #15044223 Rev. B) where all loci specific primers have a 33 bp tail added to the 5’ end ...
-
bioRxiv - Genetics 2023Quote: ... B-allele frequency (BAF) and log-likelihood (LRR) data were generated using GenomeStudio v2.0.5 (Illumina Inc.) with a custom cluster file created according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... The B allele frequency (BAF) and the log R ratio (LRR) were extracted from GenomeStudio (Illumina, USA) for representation.
-
bioRxiv - Neuroscience 2020Quote: ... The B allele frequency (BAF) and the log R ratio (LRR) were extracted from GenomeStudio (Illumina, USA) for representation.
-
bioRxiv - Evolutionary Biology 2023Quote: ... cDNA libraries were prepared according to the 16S Metagenomic Sequencing Library Preparation protocol (15044223 Rev. B, Illumina). Libraries were indexed using Nextera XT Index Kit (FC-131-1002/Illumina) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplicons were calculated for their nano-molarity and diluted to 4 nM (see Illumina 470-2016-007-B) for HTS run on MiSeq sequencer using the Illumina MiSeq Reagent Kit Version 3 (600bp pair-ended) ...
-
bioRxiv - Genomics 2020Quote: ... Log R Ratio and B Allele Frequency were extracted using Genome Studio 2.0 (Illumina, San Diego, California, USA). Data available upon request.
-
bioRxiv - Immunology 2021Quote: ... Paired end reads of 150nt were generated for each B-cell enriched library using the MiSeq sequencer (Illumina). The 5’ gene expression libraries were sequenced following 10X Genomics read length guidelines on the NovaSeq6000 sequencer (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... which were further processed using the 16S Metagenomic Sequencing Library Preparation Protocol (Part No. 15044223 Rev. B – Illumina). Amplifications were carried out using a Verity Thermocycler (Applied Biosystem ...
-
bioRxiv - Immunology 2024Quote: ... The PCR products were then tagged using the Nextera XT Index Kit v2 Sets A to B (Illumina), with the amplicon concentrations normalized to 200 ng/µl via the Qubit high sensitivity dsDNA assay before pooling ...
-
bioRxiv - Microbiology 2020Quote: ... Library preparation was carried out according to the MiniSeq System Denature and Dilute Libraries Guide (Protocol A, Illumina b). We combined 500 µL of the denatured and diluted 16S rRNA library (1.8 pM ...
-
bioRxiv - Neuroscience 2022Quote: ... B allele frequency and log R ratio of each single nucleotide polymorphism (SNP) marker were collected from GenomeStudio (Illumina) and analyzed with PennCNV [70] and QuantiSNP [10] with default parameter settings ...
-
bioRxiv - Genomics 2020Quote: ... We performed adapter ligation using Illumina TruSeq Single DNA Indexes Set A and Set B (Illumina, San Diego, USA), and performed adaptor enrichment using (8 ...
-
bioRxiv - Neuroscience 2023Quote: ... and sorted directly into RT Reagent B (10X genomics) and further processed according to the company’s guide and sequenced using a NovaSeq 6000 (Illumina). Commercially available anti-nuclear pore complex proteins antibodies from BioLegends ...
-
bioRxiv - Immunology 2023Quote: ... Spatial transcriptomes were prepared according to the Visisum Protocol CG000239 Rev B: Libraries were sequenced as PE150 by Illumina sequencing to >80% saturation.
-
bioRxiv - Genetics 2021Quote: ... Individual RNA samples for transcriptome analysis were converted into 3′-prime specific MACE libraries (Bojahr et al. 2016) and sequenced with 1x 75 b reads on a HiSeq 2000 machine (Illumina) resulting in 3,1 - 5 million quality filtered reads ...