Labshake search
Citations for Illumina :
1 - 50 of 289 citations for Anion Exchange Membranes Thickness 10 13 µm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µL of 10 µM Nexterra N7XX (Illumina) primer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µL of 10 µM RPI-X primer (Illumina), 1 µL of 10 µM P5-TSO primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 13 pM library was loaded on the Illumina MiSeq® with 10% PhiX using a 2 × 300 bp V3 chemistry (Illumina Inc., CA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of the forward and reverse fusion primers (10 µM; including Illumina sequencing adapters; SI6), 2 µl of the cleaned-up PCR product ...
-
bioRxiv - Microbiology 2022Quote: ... Metagenomic libraries were prepared for 13 samples following the manufacturer’s instructions (Illumina Inc.). Sequencing was performed on an Illumina NovaSeq 6000 platform with a 2 × 150 bp paired-end run at Berry Genomics Co ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2.5 µL of 10 µM primer mix (515F forward and 806R reverse rRNA gene V4 primers with Illumina MiSeq adaptors), and 30 ng of sample DNA ...
-
bioRxiv - Bioengineering 2022Quote: ... amplified (13 cycles) and indexed for sequencing with the Nextera XT v2 DNA sample preparation kit (Illumina) using custom primers enabling 3’-targeted amplification ...
-
bioRxiv - Genomics 2021Quote: ... 11 kb and 13 kb) were prepared following Nextera protocol (Nextera Mate Pair sample preparation kit, Illumina). Each library was sequenced using 100 base-length read chemistry on a paired-end flow cell on the Illumina HiSeq2000 (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... amplified (13 cycles) and indexed for sequencing with the Nextera XT v2 DNA sample preparation kit (Illumina) using custom primers enabling 3’-targeted amplification ...
-
bioRxiv - Microbiology 2022Quote: ... Index PCR was performed with 13 cycles using IDT for Illumina Nextera DNA Unique Dual Indexes (Illumina). Obtained libraries were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2024Quote: ... Sequences for the 13 landraces were generated using the Illumina TruSeq DNA Nano Prep followed by Illumina NovaSeq 6000 sequencing with 150-bp paired-end technology to a target depth of 40x.
-
bioRxiv - Genomics 2021Quote: ... 0.4 µM oligo 1 (a truncated Illumina read 1 sequence followed by six random bases ...
-
bioRxiv - Microbiology 2022Quote: ... The samples from the French estuaries (13, 35, 48, 78 and 79) we were sequenced using MiSeq (Illumina) by the company ID-Gene Ecodiagnostics (Geneva ...
-
bioRxiv - Genomics 2024Quote: ... 13 individuals exhibited MR exceeding 15% (refer to Table S1) were subsequently sequenced on HiSeq or NovaSeq (Illumina) with 150 bp or 100 bp paired-end at the National Institute of Genetics ...
-
bioRxiv - Genetics 2020Quote: The phage L cI−40 13−am43 genome was sequenced at New England Biolabs by combining data from Illumina and PacBio RS2 methods ...
-
bioRxiv - Genomics 2024Quote: ... The libraries were pooled and sequenced across 13 lanes of NovaSeq S4 flow cells (Illumina, San Diego, CA, USA) for 150 bp paired end reads with a 5% PhiX spike-in to generate ∼200 million reads (∼8-12x coverage ...
-
bioRxiv - Cancer Biology 2021Quote: ... 9 samples with DNA >40kbp were concurrently sequenced using PacBio and Illumina and the remaining 13 tumor samples were sequenced by Illumina WGS only ...
-
bioRxiv - Genomics 2021Quote: ... DNA was PCR amplified for a total of 11-13 cycles using barcoded primers (Illumina Nextera XT Index Kit v2) and purified using Ampure beads (1.4:1 beads:sample ratio) ...
-
bioRxiv - Genomics 2022Quote: Whole-genome shotgun libraries of 13 Capsicum lines were prepared with the TruSeq DNA PCR-Free Sample Prep Kit (Illumina), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... was performed at 13-16 million reads per sample in single-end mode with 100 cycles on the NextSeq 2000 platform (Illumina). Demultiplexed FASTQ files were generated with bcl-convert v4.0.3 (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... 0.1 µM each primer (Primer1 and Primer2 for Illumina), 0.3 mM dNTP ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... the purified amplicons were sequenced using the MiSeq reagent kit v2 (13 cycles) on the MiSeq platform (Illumina, Inc., CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... 0.2 µM of each primer (Primer1 and Primer3 for Illumina), 0.6 mM dNTP ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 µM i5 and i7 Illumina index primers (Illumina, 20027213) and NEBNext Ultra II Q5 Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4 µM of each primer (Nextera, Illumina, San Diego, CA, USA), 12.5 µL PCR Multiplex Plus buffer (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... Tn5059 was diluted to 4.2 µM in standard storage buffer (Illumina), and 1 µL was added to each well of 384-well plate ...
-
bioRxiv - Plant Biology 2020Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling (13-16 samples per lane in equal representation) and sequencing on the NextSeq500 platform (Illumina, San Diego, California, USA) paired-end 2×150 bp High Output.
-
bioRxiv - Genomics 2024Quote: ... It consisted of 13 trios from the endangered Mexican Wolf (MW, Canis lupus baileyi) population genotyped using the Illumina CanineHD BeadChip array (Illumina, Inc., San Diego, CA). The MW population was reintroduced into the wild in the 1990s ...
-
bioRxiv - Microbiology 2020Quote: ... and 10% PhiX (Illumina) spike-in ...
-
bioRxiv - Microbiology 2020Quote: ... one PCR reaction of 12 cycles was performed (using 2 µL of 3C library, 0.2 µM Illumina primers PE1.0 and PE2.0 and 1 unit of Taq Phusion [Finnzymes]) ...
-
bioRxiv - Developmental Biology 2023Quote: ... P2 100 cycles (Read1-28; Read2-90; Index1-10; Index2-10) (Illumina, cat no. 20046811). Cell Ranger version 6 and version 7.1 (for batch 1 and batch 2 respectively ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added to the pooled amplicon library prior to running the sample on a Miseq Sequencer System (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added to the pooled amplicon library prior to running the sample on an Miseq Sequencer System (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added to the pooled amplicon library prior to running the sample on an Miseq Sequencer System (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... and analyzed using iScan (10) (Illumina). Raw idat files were processed using GenomeStudio Version 2.0 (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added prior to running the sample on an Miseq Sequencer System (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... adding 10% PhiX spike-in (Illumina).
-
bioRxiv - Genomics 2024Quote: ... 10% dimethylformamide) supplemented with Tn5 (Illumina, 20034197 ...
-
bioRxiv - Genomics 2021Quote: ... was generated and we incubated 7 µM Tn5059 with 10 µM annealed transposon for 30 min at room temperature and then diluted to 0.7 µM Tn5059 transposome complex with standard storage buffer (Illumina).
-
bioRxiv - Cell Biology 2022Quote: ... (Illumina HiSeq, single index, 10 samples/lane), and underwent RiboZero Gold purification ...
-
bioRxiv - Cancer Biology 2024Quote: ... including a 10% PhiX spike-in (Illumina) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.8 µl 100 µM barcoded CRISPR KO primer (oMCB1440, aatgatacggcgaccaccgagatctacacGATCGGAAGAGCACAC GTCTGAACTCCAGTCAC NNNNNN CGACTCGGTGCCACTTTTTC, where NNNNNN is an Illumina TruSeq index), and 69.4 µl nuclease-free water were added to the 5 µl PCR1 reaction ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Libraries were diluted to 2 nM in 10 μL 10 mM Tris-HCl (pH 8.5) and sequenced on a HiSeq2500 (Illumina) using a v2 Rapid SR50 cartridge (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Systems Biology 2023Quote: ... then loaded at 0.75nM and sequenced paired-end (Rd1:28 Rd2:10 Rd3:10 Rd4:50) on a Novaseq 6000 (Illumina).
-
bioRxiv - Genomics 2023Quote: ... We used 15 mins incubation on ice in the nuclei preparation step and the Tn5 reaction was performed in 50 μl of custom transposition buffer (10 mM Tris pH 8, 5 mM MgCl2 and 10% dimethylformamide) with 2.5 μl Tn5 transposase (Illumina, 20034197) at 37°C while mixing at 1000 rpm for 30 mins ...
-
bioRxiv - Cancer Biology 2023Quote: ... spiked with 10% commercially prepared PhiX library (Illumina) and sequenced as 100 base single end reads on an Illumina HiSeq 2500 using TruSeq Rapid SBS sequencing kit version 1 and HCS version 2.0.12.0 data collection software (Illumina ...