Labshake search
Citations for Illumina :
101 - 150 of 332 citations for Adenovirus Type 5 Particles CMV Luciferase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
bioRxiv - Immunology 2021Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... 5 µl nuclease and 2.5 µl Tn5 transposase enzyme (TDE1, Illumina, catalog # 15027865) and incubated for 28 minutes at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... the 5’ Illumina adapter (as used in the Illumina TruSeq Small RNA kit) and a split 2x 3 nt Unique Molecular Identifier (UMI ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli transposition assays were mixed with 5 µL of tagmentation DNA buffer (Illumina) and 1 µL of amplicon tagmentation mix (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... with a loading sample concentration of 10pM and a 5% PhiX (Illumina, U.S.) spike-in ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µg of total cellular RNA was depleted of ribosomal RNA (RiboZero kit, Illumina), and subjected to base hydrolysis ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2023Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μg DNase-treated RNA was used as input for ribosomal depletion using the Epicentre (Illumina) Ribo-Zero ribosomal depletion kit (Cat# SCL24H) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mRNA 5′ end libraries were multiplexed again and then sequenced on HiSeq 4000 (Illumina) using paired-end (2x 100 cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... Completed libraries were pooled in an equimolar ratio along with 5% PhilX Control Library V3 (Illumina), denatured and diluted to 2.0pM as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... parental fish were whole-genome sequenced with 5–10X coverage (Illumina Hiseq platforms, BGI Hong Kong). The genotyping of F1 fish was carried out with the DarTseq technology (Diversity Arrays Technology ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 pM of DNA library spiked with .5% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina).
-
bioRxiv - Genetics 2021Quote: ... We find that even sequencing error rates as high as 5% (50x higher than Illumina sequencer error) have very little effect on clustering quality under most correlation cut-offs ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were sequenced (5’ single end; single-end 75x) using the NextSeq500 high-throughput sequencing system (Illumina) at the Cornell University Biotechnology Resource Center ...
-
bioRxiv - Developmental Biology 2019Quote: ... Pools of 4 or 5 multiplexed libraries were loaded per lane of a HiSeq 2000 sequencer (Illumina) at 8 pM and single-end sequenced using the 100 bp protocol.
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... and 2-5 cm inferior to the navel.24,38 Sequencing was performed on a HiSeq2000 (Illumina®), fastq files were mapped to the human reference genome hg19 ...
-
bioRxiv - Cell Biology 2021Quote: ... The purified DNA was PCR amplified for 5 cycles using a Nextera DNA Library Index kit (Illumina) and Phusion HF Master Mix (New England BioLabs ...
-
bioRxiv - Microbiology 2020Quote: ... was performed with ~5 million reads / sample in single-end mode on the NextSeq 500 platform (Illumina), using the High Output Kit v2.5 (75 cycles) ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 5 μg total RNA samples were treated with the Ribo-Zero™ rRNA removal procedure (Illumina) to enrich for mRNA ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in ATAC lysis buffer for 5 min and then transposed with TN5 transposase (Illumina) for 30 min ...
-
bioRxiv - Genomics 2022Quote: ... We partitioned the genes into three categories: (1) >5-fold higher in Illumina (“Higher count in Illumina”); (2 ...
-
bioRxiv - Biochemistry 2020Quote: 5 µg total RNA isolated from Flag elution samples were treated with Yeast RiboZero Gold (Illumina, MRZY1306) according to the manufacturer’s instructions to remove yeast rRNAs from the samples ...
-
bioRxiv - Genomics 2021Quote: ... Nuclear isolation of 5×10^4 cells was followed by treatment with Nextera Tn5 enzyme (Illumina, 20034198) for 45 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... The 5’GEX libraries were sequenced each of on a separate lane of HiSeq4000 flow cell (Illumina) to target sequencing depth of 50,000 read pairs per sample ...
-
bioRxiv - Immunology 2022Quote: ... cells were lysed in ATAC lysis buffer for 5 minutes and then transposed with TN5 transposase (Illumina) for 30 minutes at 37°C ...