Labshake search
Citations for Illumina :
1 - 50 of 334 citations for Adenovirus Type 5 Particles CMV β galatosidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and 5 mM β-mercaptoethanol) and then subjected the nuclei to a transposition reaction with Tn5 (Illumina). The transposition reaction was performed with 25 μl of 2x DMF (66 mM Tris-acetate pH 7.8 ...
-
bioRxiv - Microbiology 2021Quote: ... (Canada) (Sequencing type: Illumina NovaSeq 6000 S4 PE100 - 25M reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... Illumina array type (Illumina Infinium MethylationEPIC or Methylation450K BeadChip) ...
-
bioRxiv - Neuroscience 2020Quote: ... 50bp RNA-seq of IP fractions and total homogenate from 5 replicates per cell type (20 samples total) was performed on a single lane of a HiSeq 3000 (Illumina, San Diego, California), yielding ∼350M reads ...
-
bioRxiv - Genomics 2020Quote: Three types of sequencing reads from Illumina, PacBio ...
-
IRF1 regulates self-renewal and stress-responsiveness to support hematopoietic stem cell maintenancebioRxiv - Cell Biology 2023Quote: ... Sequencing was performed using Nova Seq S4 (run type: PE100, type of library: NexteraXT, 25 million reads per sample; Illumina). Preprocessing and analysis were done using Galaxy Quality and adapter trimming of reads was performed using RNA Galaxy workbench 2.058 ...
-
bioRxiv - Plant Biology 2021Quote: ... biological replicates for each of eleven tissue types from Illumina mRNA-seq libraries were aligned independently using STAR v2.5.3a (Dobin et al. ...
-
bioRxiv - Microbiology 2021Quote: ... A draft wild type phi47 genome was assembled de novo from Illumina reads obtained from MiGS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Both types of arrays were scanned on a NextSeq 550 system (Illumina). HMW genomic DNA was sequenced to ∼30x coverage on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... The first type consists of Labyrinthula transcripts generated in this study by sequencing (Illumina) and assembling the transcriptome (Haas et al ...
-
bioRxiv - Genetics 2022Quote: DMDSC genotyping was conducted for approximately 5,801 patients with type 2 diabetes by Illumina using the global screening arrays version (GSA v1.0) ...
-
Alzheimer’s patient brain myeloid cells exhibit enhanced aging and unique transcriptional activationbioRxiv - Neuroscience 2019Quote: ... The libraries were multiplexed within cell types and then sequenced on Illumina HiSeq2500 (Illumina) to generate 50M of single end 50bp reads.
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genomics 2021Quote: ... HLA types were further confirmed with ImmunoArray-24 BeadChip v2.0 (Infinium) or HumanImmuno BeadChip v1.0 (Illumina) and HLA imputation [36] ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Genomics 2020Quote: ... Libraries for each sample type were prepared using the TruSeq Stranded Total RNA Library Prep Kit (Illumina), multiplexed and 75 bp paired-end sequenced over 4 lanes on an Illumina NextSeq 500 Sequencing System at the sequencing core facility at LANGEBIO ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Genomics 2019Quote: WGS libraries were prepared using optimized Illumina protocols depending on DNA type (Illumina, San Diego, California, United States). The Early Access FFPE-extracted gDNA Library preparation kit (Illumina ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries of both TCRα and β were then subjected to paired-end sequencing using a Miseq (Illumina) according to the protocol for Miseq Reagent Kit v3 (Illumina).
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Cell Biology 2019Quote: ... For all cell types libraries were prepared using a TruSeq Stranded Total RNA Kit with Ribo-Zero Gold (Illumina) using 200ng of RNA ...
-
bioRxiv - Genomics 2022Quote: Combined with four types of libraries constructed: (1) the short-read sequencing library with 350-bp insertions from Illumina HiSeq X Ten instrument platforms ...
-
bioRxiv - Neuroscience 2021Quote: All three mutants were outcrossed three to four times with a wild-type genetic background and sequenced by Illumina Hi-Seq 2500 (single-read ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Developmental Biology 2020Quote: Pearson correlations were calculated among all genes across a catalog of 38 tissues/cell types derived from all three germ layers (16 Illumina BodyMap 2.0 tissues ...
-
bioRxiv - Genetics 2019Quote: Libraries for three edited samples and three wild type controls were processed following TruSeq RNA library prep kit v2 protocol (Illumina). RNA-Seq reads were aligned to GRCh38 ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing libraries were constructed using TruSeq stranded mRNA method and sequenced using run type PE100 on an Illumina NovaSeq6000 sequencer (Illumina). RNA quality assessment and RNA-seq were conducted at the IGM Genomics Center ...
-
bioRxiv - Cancer Biology 2022Quote: ... equal amount of RNA from each sample or cell types were used to generate the library using the TruSeq RNA Sample Prep Kit v.2 (Illumina). Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: All 450K array methylation level files were downloaded (Data Type: “Methylation beta value”, Platform: “Illumina Human Methylation 450”; n = 507). The average CpG methylation level over DMRs identified in this study and GENCODE transcript promoters was calculated in all TCGA LUAD and matched normal samples ...
-
bioRxiv - Plant Biology 2023Quote: ... together with a wild type (WT) plant were whole genome sequenced with an Illumina sequencer (Illumina Inc., San Diego, USA). One μg of DNA was used to prepare short insert (length 350 bp ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Molecular Biology 2021Quote: Libraries from human liver tissue and wild type FL83B cells were prepared with TruSeq Stranded Total RNA Library Prep Gold (Illumina, #20020599), single-read sequencing was performed using the NextSeq 500 (Illumina) ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Genomics 2020Quote: ... Samples were prepared separately from each of the three biological replicates of each tissue type using the TruSeqTM RNA Sample Preparation Kits (v2) and sequenced using the Illumina HiSeq 2500 instrument (Illumina Inc., USA) at the Center for Genomic Research and Biocomputing ...