Labshake search
Citations for Illumina :
1 - 50 of 306 citations for Adenovirus Type 3 Particles Wild type since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... A draft wild type phi47 genome was assembled de novo from Illumina reads obtained from MiGS ...
-
bioRxiv - Microbiology 2021Quote: ... (Canada) (Sequencing type: Illumina NovaSeq 6000 S4 PE100 - 25M reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... Illumina array type (Illumina Infinium MethylationEPIC or Methylation450K BeadChip) ...
-
bioRxiv - Neuroscience 2021Quote: All three mutants were outcrossed three to four times with a wild-type genetic background and sequenced by Illumina Hi-Seq 2500 (single-read ...
-
bioRxiv - Genetics 2019Quote: Libraries for three edited samples and three wild type controls were processed following TruSeq RNA library prep kit v2 protocol (Illumina). RNA-Seq reads were aligned to GRCh38 ...
-
bioRxiv - Plant Biology 2023Quote: ... together with a wild type (WT) plant were whole genome sequenced with an Illumina sequencer (Illumina Inc., San Diego, USA). One μg of DNA was used to prepare short insert (length 350 bp ...
-
bioRxiv - Molecular Biology 2021Quote: Libraries from human liver tissue and wild type FL83B cells were prepared with TruSeq Stranded Total RNA Library Prep Gold (Illumina, #20020599), single-read sequencing was performed using the NextSeq 500 (Illumina) ...
-
bioRxiv - Genomics 2020Quote: Three types of sequencing reads from Illumina, PacBio ...
-
IRF1 regulates self-renewal and stress-responsiveness to support hematopoietic stem cell maintenancebioRxiv - Cell Biology 2023Quote: ... Sequencing was performed using Nova Seq S4 (run type: PE100, type of library: NexteraXT, 25 million reads per sample; Illumina). Preprocessing and analysis were done using Galaxy Quality and adapter trimming of reads was performed using RNA Galaxy workbench 2.058 ...
-
bioRxiv - Plant Biology 2021Quote: ... biological replicates for each of eleven tissue types from Illumina mRNA-seq libraries were aligned independently using STAR v2.5.3a (Dobin et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... Both types of arrays were scanned on a NextSeq 550 system (Illumina). HMW genomic DNA was sequenced to ∼30x coverage on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... The first type consists of Labyrinthula transcripts generated in this study by sequencing (Illumina) and assembling the transcriptome (Haas et al ...
-
bioRxiv - Genetics 2022Quote: DMDSC genotyping was conducted for approximately 5,801 patients with type 2 diabetes by Illumina using the global screening arrays version (GSA v1.0) ...
-
Alzheimer’s patient brain myeloid cells exhibit enhanced aging and unique transcriptional activationbioRxiv - Neuroscience 2019Quote: ... The libraries were multiplexed within cell types and then sequenced on Illumina HiSeq2500 (Illumina) to generate 50M of single end 50bp reads.
-
bioRxiv - Genomics 2021Quote: ... HLA types were further confirmed with ImmunoArray-24 BeadChip v2.0 (Infinium) or HumanImmuno BeadChip v1.0 (Illumina) and HLA imputation [36] ...
-
bioRxiv - Genomics 2020Quote: ... Libraries for each sample type were prepared using the TruSeq Stranded Total RNA Library Prep Kit (Illumina), multiplexed and 75 bp paired-end sequenced over 4 lanes on an Illumina NextSeq 500 Sequencing System at the sequencing core facility at LANGEBIO ...
-
bioRxiv - Genomics 2019Quote: WGS libraries were prepared using optimized Illumina protocols depending on DNA type (Illumina, San Diego, California, United States). The Early Access FFPE-extracted gDNA Library preparation kit (Illumina ...
-
bioRxiv - Cell Biology 2019Quote: ... For all cell types libraries were prepared using a TruSeq Stranded Total RNA Kit with Ribo-Zero Gold (Illumina) using 200ng of RNA ...
-
bioRxiv - Genomics 2022Quote: Combined with four types of libraries constructed: (1) the short-read sequencing library with 350-bp insertions from Illumina HiSeq X Ten instrument platforms ...
-
bioRxiv - Developmental Biology 2020Quote: Pearson correlations were calculated among all genes across a catalog of 38 tissues/cell types derived from all three germ layers (16 Illumina BodyMap 2.0 tissues ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing libraries were constructed using TruSeq stranded mRNA method and sequenced using run type PE100 on an Illumina NovaSeq6000 sequencer (Illumina). RNA quality assessment and RNA-seq were conducted at the IGM Genomics Center ...
-
bioRxiv - Cancer Biology 2022Quote: ... equal amount of RNA from each sample or cell types were used to generate the library using the TruSeq RNA Sample Prep Kit v.2 (Illumina). Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: All 450K array methylation level files were downloaded (Data Type: “Methylation beta value”, Platform: “Illumina Human Methylation 450”; n = 507). The average CpG methylation level over DMRs identified in this study and GENCODE transcript promoters was calculated in all TCGA LUAD and matched normal samples ...
-
bioRxiv - Genomics 2020Quote: ... Samples were prepared separately from each of the three biological replicates of each tissue type using the TruSeqTM RNA Sample Preparation Kits (v2) and sequenced using the Illumina HiSeq 2500 instrument (Illumina Inc., USA) at the Center for Genomic Research and Biocomputing ...
-
bioRxiv - Cancer Biology 2020Quote: ... MCF10A libraries from three biological replicates of each cell type were prepared using NEBNext® Ultra(tm) RNA Library Prep Kit (Illumina®) and sequenced on HiSeq X by Annoroad Gene Technology Ltd ...
-
bioRxiv - Neuroscience 2020Quote: ... 50bp RNA-seq of IP fractions and total homogenate from 5 replicates per cell type (20 samples total) was performed on a single lane of a HiSeq 3000 (Illumina, San Diego, California), yielding ∼350M reads ...
-
bioRxiv - Physiology 2023Quote: ... All libraries within a tissue type were pooled to equimolar amounts and sequenced on two lanes of an Illumina NovaSeq (Illumina, San Diego, CA) machine to obtain 150 bp paired-end reads.
-
bioRxiv - Genetics 2021Quote: ... http://www.ebi.ac.uk/ena/) under accession number (PRJEB9450).These 29 wild-caught mice were sequenced by Illumina Hiseq 2000 at the Max Planck institute (Harr et al. ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...