Labshake search
Citations for Illumina :
251 - 300 of 622 citations for 8 Chloro pyrido 3 4 b pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared using a 3′-Tag-RNA-Seq library kit (Illumina). Sequencing was performed using one lane of a Hi-Seq 4000 platform with pair-end 40 bp reads ...
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Genomics 2022Quote: ... The library was run across 4 lanes of a NovaSeq (Illumina), multiplexed with other samples.
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... puteoserpentis (499ROV/1-4) specimens using short-read (Illumina HiSeq 3000) and long-read (PacBio ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA depletion with additional probes recommended by Illumina (Table 4), stranded library preparation (Illumina Ribo-Zero Plus rRNA Depletion w/ Stranded Total RNA) ...
-
bioRxiv - Molecular Biology 2020Quote: ... High-quality RNA (RIN > 8) was used in library preparation for with the Illumina TruSeq stranded protocol (Illumina, San Diego, USA). Libraries were rRNA depleted using the Illumina Ribo Zero kit and sequenced as single read 75 base pair read length (SR75 ...
-
bioRxiv - Genetics 2021Quote: ... were prepared from RNA samples with a RIN (RNA integrity number) above 8 using the strand-specific TruSeq™ RNA-seq library (Illumina), and 150 bp paired-end read sequencing over three lanes of the Illumina HiSeq4000 sequencing platform was performed at the Norwegian Sequencing Centre ...
-
bioRxiv - Microbiology 2019Quote: ... Illumina barcodes and adapters were attached to pooled and purified products in a second PCR (8 cycles) with the Nextera XT Index Kit A and D (Illumina Inc.). Libraries were purified with Agencourt AMPure XP kit (Beckman coulter ...
-
bioRxiv - Immunology 2020Quote: ... The second round PCR (8 cycles, 70°C annealing temperature) was performed using Nextera XT index primers (Illumina, FC-131-2001) which introduce 8 base pair indices on the 5’ and 3’ termini of the amplicon for data demultiplexing of each sample screened ...
-
bioRxiv - Cancer Biology 2020Quote: ... libraries are pooled at 8 samples per lane and sequenced on an Illumina HiSeq 4000 sequencer (Illumina Inc, San Diego, CA) at PE 2×100 cycles ...
-
bioRxiv - Cancer Biology 2019Quote: ... libraries are pooled at 8 samples per lane and sequenced on an Illumina HiSeq 4000 sequencer (Illumina Inc, San Diego, CA) at PE 2×100 cycles ...
-
bioRxiv - Molecular Biology 2020Quote: We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the above elute as template ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples with RNA Integrity Number (RIN) >8 were subjected TruSeq Poly-A mRNA Library Pro Kit protocol 15031047 RevD (Illumina, USA) to generate indexed cDNA libraries ...
-
bioRxiv - Cell Biology 2020Quote: ... The adapter-ligated library was completed by PCR with Illumina PE primers (8-11 cycles) and the resulting directional cDNA libraries were sequenced for 50 bases in a single-read format (Illumina HiSeq2000) and analyzed with nextpresso (Graña ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... value of the samples used for library preparation was ≥8 and cDNA libraries were prepared using IlluminaTruSeq Stranded mRNA Sample Prep kit (Illumina, USA) from 4μg of total RNA according to the manufacturers’ instructions ...
-
bioRxiv - Biophysics 2023Quote: ... We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the elute as template ...
-
bioRxiv - Genomics 2022Quote: ... 500 ng of purified RNA with RNA integrity number (RIN) ≥8 was subsequently used for library preparation with the TruSeq Stranded mRNA library Prep (Illumina, #20020594) and sequenced on the Illumina NextSeq500 system using a paired-end 2×75 bp protocol ...
-
bioRxiv - Microbiology 2020Quote: ... the number of intervening days between serial isolations, time point (A or B, being earlier and later time points respectively) and sequencing technology (Illumina [I] or PacBio[P]) (Figure 3B) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The library was made according to the manufacturer’s directions for the TruSeq Stranded mRNA LT Sample Prep Kit - set B (Illumina, Cat. No. RS-122-2102). The resulting short fragment library was checked for quality and quantity using the LabChip GX (PerkinElmer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA was extracted from the seedlings and libraries were constructed from three independent biological replicates following polyA selection using instructions for TruSeq RNA library preparation (Illumina protocol 15026495 Rev. B). Libraries were sequenced on the Illumina HiSeq2500 platform generating 100 bp paired-end reads ...
-
bioRxiv - Microbiology 2019Quote: ... 1ng of each DNA sample (from B and D depths) were used for tagmentation using the Nextera XT (Illumina, Inc., San Diego, CA, USA), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Library preparation for sequencing was performed using 200 ngs of total RNA input with the TrueSeq RNA Sample Prep Kit v2-Set B (RS-122-2002, Illumina Inc, San Diego, CA) producing a 275bp Fragment including Adapters in average size ...
-
bioRxiv - Molecular Biology 2022Quote: mRNA-seq libraries were generated from 500 ng of total RNA using TruSeq® Stranded mRNA Library Prep kit and TruSeq® RNA Single Indexes kits A and B (Illumina, Cat#20020595) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: The sequencing library preparation was done using 200 ng of total RNA input with the TrueSeq RNA Sample Prep Kit v3-Set B (RS-122-2002, Illumina Inc, San Diego, CA) producing a 275 bp fragment including adapters in average size ...
-
bioRxiv - Immunology 2020Quote: ... One microgram of high quality RNA (RIN>8) was used as a template for library generation using the Illumina TruSeq RNA Sample Prep Kit v2 (Illumina; CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... which were the Infinium Global Screening Array-24 Kit™ (GSA24) and the Infinium Global Diversity Array-8 Kit™ (GDA8) from Illumina and the Axiom™ Genome-Wide Human Origins (HO ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Genomics 2019Quote: ... 4 ng ChIP DNA was incubated with transposase (Illumina, Fc-121-1030) for 10’ at 55’C ...
-
bioRxiv - Genomics 2021Quote: ... 3nM libraries were loaded across 4 lanes on the HiSeq 4000 (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 4 out of 49 samples only had microarray genotype data from Illumina Omni2.5 chips ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The final library was diluted to 4 nM using Resuspension Buffer (Illumina). The rest of the library preparation was completed following the Denature and Dilute Libraries Guide for MiniSeq System by Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Neuroscience 2019Quote: ... When samples showed RNA Integrity Number (RIN) > 8 they were collected and RNA was further processed according to manufacturer’s protocol (Illumina, Catalog # RS-122-9004DOC) followed by sequencing by Illumina HiSeq 4000 (50 base pair single read).
-
bioRxiv - Microbiology 2021Quote: ... and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina, New England Biolabs) attached to the forward primer and the reverse primer ...
-
bioRxiv - Microbiology 2022Quote: ... with up to 100 ng DNA input following the manufacturer’s protocol using internal single-index 8 bp barcodes with TruSeq®adapters (Illumina, San Diego, CA) or the Nextera®DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Purified libraries were sequenced on Illumina MiSeq platform (reagent kits: v2 300-cycles, paired-end mode) at 8 pM loading concentration with 25% PhiX spike-in (Illumina FC-110-3001). Custom sequencing primers were spiked into reagent cartridge (well 12 ...
-
bioRxiv - Microbiology 2023Quote: ... RNA samples with RQNs ranging from 8 to 10 were used for RNA library preparation with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... The tagmentation and library preparation was performed with the Nextera DNA Library Preparation Kit with 8 cycles of PCR amplification (Illumina #FC-121-1030).
-
bioRxiv - Physiology 2023Quote: ... RNA samples with RQNs ranging from 8 to 10 were used for RNA library preparation with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and were then sent to the Swedish National Genomics Infrastructure’s SNP & SEQ platform in Uppsala for Illumina HiSeq 2500 sequencing (8 lanes; 126 bp Paired-End sequencing; Illumina, San Diego, CA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... RNA samples with RQNs ranging from 8 to 10 were used for RNA library preparation with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). Briefly ...