Labshake search
Citations for Illumina :
701 - 750 of 2597 citations for 8 Chloro 1 2 3 4 tetrahydro 1 4 methylphenyl sulfonyl 5H 1 benzazepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... One pooled library containing 26 samples were sequenced on a NextSeq 500 sequencer (Illumina) using paired-end 38-base reads ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... rotundus assembly with at least one shared homozygous (based on aligned Illumina sequencing reads) inactivating mutation ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... in a fraction of one sequencing lane of an HiSeq2000 flowcell v3 (Illumina Inc.) according to standard Illumina operation procedures at Centro Nacional de Análisis Genómico (CNAG).
-
bioRxiv - Molecular Biology 2020Quote: ... One μg of total RNA was reverse transcribed with the partial P7 adapter (Illumina_4N_21T) and dNTPs with the addition of spiked-in azido-nucleotides (AzVTPs ...
-
bioRxiv - Genomics 2021Quote: ... All libraries were sequenced in one sequencing run on NextSeq 500 high-output (Illumina) with 85 bp single-end reads ...
-
Robust Cancer Mutation Detection with Deep Learning Models Derived from Tumor-Normal Sequencing DatabioRxiv - Genomics 2019Quote: ... and the last one was constructed by combining 9 NovaSeq sequencing replicates from Illumina to get a replicate pair with ∼390× coverage ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... One library was prepared for each individual using the TruSeq Stranded mRNA protocol (Illumina) and cDNA was sequenced on an Illumina NovaSeq 6000 to generate an average of 87 million 150 bp paired-end reads per library (Table S1) ...
-
bioRxiv - Genomics 2020Quote: ... The resulting libraries were sequenced with one sample per lane using the NextSeq500 (Illumina; high-output mode ...
-
bioRxiv - Immunology 2021Quote: ... The libraries were multiplexed and sequenced using one flow cell on Novaseq 6000 (Illumina) as 50bp paired-end reads ...
-
bioRxiv - Genomics 2021Quote: ... The pooled final library was sequenced on one to four lanes of HiSeq2000 (Illumina) with 68 base (Y ...
-
bioRxiv - Cancer Biology 2023Quote: ... One barcoded library was prepared per plate using TD buffer and TDE1 enzyme (Illumina) for tagmentation and KAPA HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Genomics 2023Quote: ... cycle one begins with incorporation of the first nucleotide in Incorporation Mix (Illumina MiSeq), followed by incubation with shaking at 60°C for 3 min ...
-
bioRxiv - Plant Biology 2023Quote: ... one microgram of crosslinked enriched chloroplasts was resuspended in 1X Tn5 reaction buffer (Illumina) and assayed according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and run in one lane on a flow cell of NovaSeq 6000 SP (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... MDA-amplified PCR products were then diluted to DNA concentrations of 0.2 ng μL−1 and used in metagenomic library preparations with the Nextera XT DNA Library Prep Kit (Illumina, San Diego), then quantified on an Agilent 2100 Bioanalyzer System (Agilent Genomics ...
-
bioRxiv - Molecular Biology 2020Quote: Libraries of eDNA and iDNA samples at 50 ng μL−1 were sequenced using a MiSeq PE300 benchtop sequencer (Illumina, USA). Library preparation was done with a TruSeq DNA PCR-Free kit (LT Lib PREP KT-ST B PhiX control v3) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Illumina TruSeq RNA libraries were prepared from 1 μg total RNA and sequenced to generate 50 base pair single-end reads using the the HiSeq 1500 (Illumina, USA) at the Children’s Mercy OMICs Research Core Lab (Kansas City ...
-
bioRxiv - Microbiology 2019Quote: ... Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Whole genome sequencing data has been deposited in the Sequence Read Archive under PRJNA529870.
-
bioRxiv - Neuroscience 2020Quote: ... RNA-seq libraries were prepared from 1 μg of total RNA using the TruSeq Stranded mRNA LT Sample Prep kit (Illumina, USA). Sequencing was performed on the Illumina NovaSeq 6000 (CNS-RNA-seq cohort subset ...
-
Cis-regulatory divergence underpins the evolution of C3-C4 intermediate photosynthesis in MoricandiabioRxiv - Plant Biology 2021Quote: ... cDNA libraries were prepared using 1 μg of total RNA with the TruSeq RNA Sample Preparation Kit (Illumina, San Diego, USA). The cDNA library was qualified on the Agilent Technologies 2100 Bioanalyzer to check the library quality and fragment size of the sample ...
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing libraries were constructed from 1 ng of pre-amplified cDNA using DNA library preparation kit (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme). Libraries were sequenced on a HiSeq-PE150 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 µg of total RNA was used for library preparation using the TruSeq Stranded mRNA kit (Illumina, cat# RS-122-2103) after rRNA depletion using Ribo-Zero plus (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... 1 µg of gDNA per sample was analyzed using the TruSeq® DNA PCR-Free Low-Throughput Library Prep Kit (Illumina) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... and sequenced on an Illumina NovaSeq using single-end 1×100 reads with the Illumina NovaSeq SP reagent kit (Illumina, 20027464). A total of 122,190,150 raw sequence reads (mean of 4,213,453 per sample (n = 29 ...
-
bioRxiv - Cell Biology 2019Quote: ... Total RNA (1 μg) was used for extracting rRNA using the Ribo-Zero rRNA Removal Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The sequencing was performed by doing a cluster generation and 150 cycles paired-end sequencing of the 24 libraries in 1 lane using the HiSeq X system and v2.5 sequencing chemistry (Illumina Inc., USA). Read data were delivered to us as fastq.
-
bioRxiv - Molecular Biology 2021Quote: RNA-seq libraries were prepared with 1 µg of total RNA for each sample using the Illumina TruSeq mRNA kit (Illumina, USA) as recommended by the manufacturer using the Illumina CD RNA indexes (Illumina ...
-
bioRxiv - Systems Biology 2020Quote: ... Final loading concentration of 1.8 pM and 1% PhiX (v/v) was used with the NextSeq® 500/550 High Output Kit v2 (150 cycles) (Illumina). Samples were sequenced paired-end with 75 cycles and single index of 6 cycles.
-
bioRxiv - Immunology 2020Quote: ... Pooled libraries of 1 nM were denatured and diluted as per the Standard Normalization Method for the NextSeq® System (Illumina). Final loading concentration of 1.7 pM and 1% (v/v ...
-
bioRxiv - Immunology 2020Quote: ... Final loading concentration of 1.7 pM and 1% (v/v) PhiX was used with the NextSeq® 500/550 High Output Kit v2 (150 cycles) (Illumina Samples were sequenced paired-end with 75 cycles of each read and single index of 6 cycles.
-
bioRxiv - Molecular Biology 2022Quote: ... PolyA + fraction (1 ng for each sample) was used for whole-transcriptome library preparation using ScriptSeq v2 RNA-Seq kit (Illumina, USA). Libraries amplified in 14 PCR cycles were purified using Agencourt AMPure XP beads (Beckman-Coulter ...
-
bioRxiv - Neuroscience 2022Quote: ... Single-end sequencing (i.e, 1×75bp) was performed in a single run on an Illumina NextSeq 500 (Illumina, San Diego, CA). Three independent experimental replicates were run for the Cebpg shRNA-mediated knockdown and shRNA control transgenic lines for a total of 6 libraries.
-
bioRxiv - Genetics 2023Quote: ... was used to isolate total RNA and approximately 1 ug of RNA was processed with the TruSeq Stranded mRNA Library Prep Kit (Illumina 20020594) to prepare libraries for paired-end sequencing on Nova-seq 6000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNAseq libraries were prepared from total RNA with the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen, 015.24) in combination with the UMI Second Strand Synthesis Module for QuantSeq FWD (Illumina, Read 1) (Lexogen ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: ... A library was independently prepared with 1 µg of total RNA for each sample by an Illumina TruSeq Stranded mRNA Sample Prep Kit (Illumina, Inc.). The first step in the workflow involved purifying the poly-A-containing mRNA molecules using poly-T-attached magnetic beads ...
-
bioRxiv - Plant Biology 2024Quote: ... total RNA from Col-0 and hakai-1 (Mock and Hpa) three biological replicates (same samples used for Illumina RNA-seq) were pooled into a single sample ...
-
bioRxiv - Microbiology 2024Quote: Libraries for Illumina short read sequencing were prepared from 1 ng of extracted DNA utilizing the Nextera XT DNA Library Prep Kit according to the manufacturer’s recommendations (Illumina Inc., USA). Sequencing was carried out in paired-end (2×300 base pairs ...
-
bioRxiv - Developmental Biology 2023Quote: ... PolyA+ RNA-seq libraries were produced from 1 µg of RNA using the TruSeq® Stranded mRNA Library Prep (Illumina, 20020594) kit ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Microbiology 2019Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... version 2 (Illumina) using 10 PCR cycles ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA (1 μg) from each sample was used for NEBNext PolyA selection and Ultra Directional RNA Library preparation (Illumina, E7490, E7420). Prepared libraries were sequenced using 2×150 bp paired-end read chemistry on an Illumina HiSeq 4000 platform.
-
bioRxiv - Molecular Biology 2021Quote: ... 1 ug of treated RNA was then input into the Illumina TruSeq Small RNA Library Preparation Kit (Illumina; Cat #: RS-200-0012) with 11 cycles of PCR amplification ...
-
bioRxiv - Genomics 2020Quote: ... Samples were prepared for sequencing using 1 ug of genomic DNA following the TruSeq PCR free kit protocol (Illumina, FC-121-3001). Resulting libraries were quality checked on an Agilent DNA 1000 bioanalyzer (Agilent Technologies ...