Labshake search
Citations for Illumina :
201 - 250 of 1712 citations for 8 Bromo 5 6 difluoro 2 methylquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 150 µl from the 14 pM pool was loaded into each well of an 8-well strip tube and loaded onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Genetics 2020Quote: ... Libraries that passed quality checks were then subjected to deep sequencing (8-47 × genome coverage; 19 × mean coverage, 11 × median coverage) by HiSeq 2500 (Illumina) or NovaSeq 6000 platforms (Illumina).
-
bioRxiv - Genetics 2019Quote: ... A subgroup of subjects comprising 48 SA and 48 non-SA were chosen for the pilot genome-wide genotyping assay in Illumina iScan system using the HumanOmni ZhongHua-8 v1.3 DNA Analysis BeadChip Kit (Illumina, Inc.) at the Li Ka Shing Institute of Health Sciences of the Chinese University of Hong Kong ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA samples with a RNA Integrity Number > 8 were used for library preparation using the protocol for the TruSeq Stranded mRNA library kit (Illumina) on the Illumina Neoprep automated microfluidic library prep instrument ...
-
bioRxiv - Molecular Biology 2020Quote: One μg of total RNA of high quality (RIN>8) was used for sequencing with a TruSeq RNA sample preparation kit (Illumina). We here included 99 islet samples in addition to the 89 islet samples and processed them uniformly following the same protocol as described previously (8) ...
-
bioRxiv - Genomics 2021Quote: ... for 4000 cells was performed according to manufacturer’s instructions and the libraries were paired-end sequenced (R1:27, i7-index:8, R2:98) on HiSeq 4000 (Illumina). Preprocessing of scRNA-seq data ...
-
bioRxiv - Microbiology 2021Quote: ... UK). Libraries were prepared from 8 samples (4× T. brucei, 4× T. congolense) using the TruSeq Stranded mRNA kit (Illumina) and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina) ...
-
bioRxiv - Neuroscience 2020Quote: ... we used one batch of 20 ng of total photoreceptor (n = 8) RNA and 30 ng for the other three batches (n = 24) according to the manufacturer’s protocol (Illumina Platforms). For generating libraries from RPE samples we used 20 ng of RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 100 μl from the 16 pM pool were loaded into each well of an 8-well strip tube and placed onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Genomics 2019Quote: ... The Agilent 2100 Bioanalyzer was used to assess RNA quality and only high quality RNA (RIN > 8) was further processed for removal of ribosomal RNA with the Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat; Illumina). Ribosomal-depleted RNA was used as input for library preparation with Illumina TruSeq V2 RNA prep kit and processed according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2020Quote: Peripheral blood DNA genotypes were obtained for 238 subjects using Infinium Multi-Ethnic Global-8 Kit (Illumina, San Diego, CA) and processed with GenomeStudio software ...
-
bioRxiv - Genetics 2020Quote: Nextera barcode adapters were added to can1 amplicons and were then minimally PCR amplified (8 cycles) for attachment of Illumina Nextera XT index primers set A (Illumina). After PCR ...
-
bioRxiv - Genomics 2020Quote: RNA from a subset of human fetal (n = 3) and mouse (n = 8) cortex tissue samples was prepared with TruSeq Stranded mRNA Sample Prep Kit (Illumina) and subjected to 125bp paired-end sequencing using a HiSeq2500 (Illumina) ...
-
bioRxiv - Immunology 2020Quote: ... High-quality RNA (approximately 500 ng; RIN 8) was used for nondirectional paired-end mRNA library preparation (TruSeq Sample Preparation Kit; Illumina).
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... Stranded RNA-Seq libraries were constructed from 100 ng high-quality total RNA (RIN > 8) using the TruSeq Stranded mRNA Library Preparation Kit (Illumina). Paired-end sequencing of 40 bases length was performed on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3’RNA libraries were prepared by GenoBiRD core facility according to their published method (47) and sequenced on 8 individual runs on a NovaSeq 6000 or HiSeq 2500 Sequencing System (Illumina).
-
bioRxiv - Cell Biology 2022Quote: ... Samples were randomised to avoid batch effects and multiplexed libraries were run on a single lane (8 samples/lane) of the HiSeq 4000 platform (Illumina) to generate 50bp single-end reads ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were randomised to avoid batch effects and multiplexed libraries were run on a single lane (8 samples/lane) of the HiSeq 2500 platform (Illumina) to generate 100bp paired-end reads ...
-
bioRxiv - Microbiology 2023Quote: ... the library was denatured with 0.1 M NaOH to generate single-stranded DNA molecules and loaded into flow cell channels at a concentration of 8 pM and amplified in situ using TruSeq Rapid SR cluster kit (# GD-402-4001, Illumina). Sequencing was performed at 100 cycles on the Illumina HiSeq 4000 according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... Multiplexing was conducted by ligating an 8-base molecular barcode to sequences before 15 cycles of PCR amplification and HiSeq 2500 (Illumina) Rapid Mode library sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA with a RNA integrity number (RIN) above 8 was used as input using TruSeq Stranded mRNA kit (Cat #: 20020594) from Illumina following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... 150µL from the 14pM pool was loaded into each well of an 8-well strip tube and loaded onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Molecular Biology 2023Quote: ... one μg of RNA (RIN>8) was used for library preparation with the Illumina Stranded total RNA Prep Ligation with Ribo-Zero Plus kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared and indexed by adapter ligation and PCR (8 cycles) using the TruSeq Nano DNA Library Prep Kit (Illumina) and TruSeq DNA Single Indexes Set A or B (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA samples with an RNA Integrity Number > 8 were used to prepare libraries following the standard protocol for the TruSeq Stranded mRNA library kit (Illumina) on the Illumina Neoprep automated microfluidic library prep instrument ...
-
bioRxiv - Microbiology 2023Quote: ... Indices were added in a second PCR over 8 cycles with unique primer combinations using the Nextera XT Index Kit V2 (Illumina). The samples were pooled and cleaned using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Paired-end sequencing (300 bp) with a dual 8-bp barcode was performed using MiSeq (Illumina, San Diego, CA, USA). The sequence reads were sorted individually using each barcode.
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing was performed in paired-end mode with an S1 flow cell (28/8/87 cycles) and a NovaSeq 6000 sequencer (Illumina) at the MGX core facility of Montpellier ...
-
bioRxiv - Plant Biology 2023Quote: ... value of 8 was employed for RNA-Seq library construction using the TruSeq Stranded Total RNA Library Prep Plant kit (Illumina). Hisat2 (Kim et al. ...
-
bioRxiv - Genomics 2024Quote: ... since the original data were produced on a different beadchip with respect to the HO and 1240K data (Infinium Omni2.5-8 Illumina beadchip). The results of the first two PCs were visualized in R-4.1.3 (https://www.r-project.org/ ...
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Cell Biology 2023Quote: ... and 20 μM reverse P7 primers with 6-bp TruSeq indices that are automatically demultiplexed by Illumina software ...
-
bioRxiv - Developmental Biology 2022Quote: ... All 6 individual libraries were pooled in equal amount and sequenced with the HiSeq 4000 platoform (Illumina). The RNA-seq data are available under the GEO accession no ...
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2019Quote: ... Then perform tagmentation using 2 μl of Tn5 transposase and 12.5 ul 2 × TD buffer (Illumina #FC-121-1031) at 37°C for 1h with 650 rpm shaking ...
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Molecular Biology 2020Quote: ... High-quality RNA (RIN > 8) was used in library preparation for with the Illumina TruSeq stranded protocol (Illumina, San Diego, USA). Libraries were rRNA depleted using the Illumina Ribo Zero kit and sequenced as single read 75 base pair read length (SR75 ...
-
bioRxiv - Genetics 2021Quote: ... were prepared from RNA samples with a RIN (RNA integrity number) above 8 using the strand-specific TruSeq™ RNA-seq library (Illumina), and 150 bp paired-end read sequencing over three lanes of the Illumina HiSeq4000 sequencing platform was performed at the Norwegian Sequencing Centre ...
-
bioRxiv - Microbiology 2019Quote: ... Illumina barcodes and adapters were attached to pooled and purified products in a second PCR (8 cycles) with the Nextera XT Index Kit A and D (Illumina Inc.). Libraries were purified with Agencourt AMPure XP kit (Beckman coulter ...