Labshake search
Citations for Illumina :
301 - 350 of 1054 citations for 8 phenylamino 5 4 5 sulpho 1 naphthyl azo 1 naphthyl azo naphthalene 1 sulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... AGENOME-ZPMS-HV2a-1 was generated by realigning the mapped mitochondrial reads from Illumina as well as Nanopore data with the initial assembly.
-
bioRxiv - Neuroscience 2023Quote: ... Paired-end 100bp sequences were generated over 1 lane by NovaSeq6000 using S4FC (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... 2 × 1 μl (concentration of 10pmol/μl) MiSeq Nextera XT adapters (dual indexed, Illumina), and 6.5 μl of mQ water (Ultrapure) ...
-
bioRxiv - Genomics 2023Quote: ... PCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1, E7335) and amplified to linear phase ...
-
bioRxiv - Genomics 2023Quote: ... qPCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1, E7335) and amplified to linear phase (3-5 PCR cycles).
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were sequenced single-end (1 × 50 bp) on the HiSeq 2500 platform (Illumina) or paired-end (2 × 100 bp ...
-
bioRxiv - Immunology 2024Quote: ... and sequencing was conducted with a 1×100 bp single-end read configuration (Illumina). Each sample was sequenced to a minimum depth of 30 million reads using the NovaSeq6000 system (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genetics 2021Quote: ... The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were collected and subject to tagmentation at 37 °C for 30 minutes in adjusted tagmentation buffer (2x TD Tagment buffer + Digitonin 0.01% + 5 ul of TDE Tagment DNA enzyme from Illumina). Reaction was stopped with 0.2% SDS and DNA was collected using Qiaquick PCR purification columns and eluted in 10 μl 10 mM Tris ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dual indexed sequencing libraries were made out of 5 ng cDNA from the above preparations using Illumina Nextera library preparation kit according to manufacturer’s instructions (Illumina). Quality checked and equimolar pooled libraries were sequenced in a HiSeq 4000 Illumina system ...
-
bioRxiv - Cell Biology 2020Quote: ... rRNA was depleted from 5 μg of total RNA using the Ribo-Zero Gold Yeast rRNA Removal Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... since values ΔCq > 5 are not suitable for further downstream processing for Infinium HD FFPE Restore Protocol (Illumina, Inc.) and Infinium MethylationEPIC array (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... Ribosomal RNA (rRNA) was depleted from 5 ug of total RNA using the Ribo-ZeroTM Gold Kit (Illumina, Inc). Depleted mRNA was fragmented and converted to first-strand cDNA using Superscript III reverse transcriptase (Invitrogen) ...
-
bioRxiv - Genomics 2021Quote: ... and 5K samples were resuspended in 50 μl, 10 μl, and 5 μl of transposition mix (25 μl 2x TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: Gene expression data was generated with the Chromium Single Cell 5’ v3.1 assay (10X Genomics) and sequenced on the NovaSeq 6000 platform (S1 flow cell, Illumina). To generate gene-barcode count matrices ...
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Microbiology 2019Quote: Samples were genotyped using the Infinium CoreExome-24v1-1 Chip (Illumina, San Diego, CA, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2019Quote: ... and sequenced on 1 lane of an Illumina HiSeq 4000 (Illumina, San Diego, CA, USA) with single-end 100 bp reads ...
-
bioRxiv - Genomics 2020Quote: ... 1 μg of total RNA was used with the TruSeq RNA library preparation kit (Illumina) in accordance with the low-throughput protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... Expression in cohort 1 was measured using HumanHT-12 v4 Expression Beadchip microarrays (Illumina, Inc.) with ∼44k probes ...
-
bioRxiv - Developmental Biology 2022Quote: ... The samples were then resuspended in 1 ml of ATAC mix (2X TDE buffer (Illumina), 50 µl TDE (Illumina) ...
-
bioRxiv - Cell Biology 2019Quote: ... The libraries were sequenced in 1 x 100 +7 manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... RPS6KA1 expression is provided as RSEM (Batch normalized from Illumina HiSeq_RNASeq V2 (log2(value+1)).
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries were prepared from 1 ug of RNA following TruSeq Stranded Total RNA kit (Illumina) with two technical replicates for each sample ...
-
bioRxiv - Microbiology 2019Quote: ... In study 1 the viral DNA was used directly for Nextera XT library preparation (Illumina) as described by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were checked on a 1% agarose gel and positives were sequenced by Illumina sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ng purified amplicons were processed with the Nextera XT DNA Library Preparation Kit (Illumina) and subsequently sequenced using the MiSeq reagent Kit v2 as described above.
-
bioRxiv - Genetics 2021Quote: ... Sequencing was carried out in single-end mode (1×75 bp) by using NextSeq500 (Illumina) with a targeted sequencing depth of about 40 million reads per sample ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1–2 mg of total RNA was used for Ribo-Zero rRNA Removal kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl of Nextera XT index primers 1 and 2 (Nextera XT Index kit, Illumina) and 2.5 μl of templated DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 1 U PCRBIO HiFi Polymerase (PCR Biosystems) and 10 µL of Nextera adaptor mix (Illumina). PCR conditions were 95°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... ∼1 µg of RNA was used to construct libraries with Truseq Stranded mRNA kit (Illumina) and barcoded with IDT for Illumina-TruSeq DNA and RNA UD Indexes ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA fragments were then amplified by PCR using Nextera index primer 1 and 2 (Illumina) and produced by PCR amplification (10–13 cycles ...
-
bioRxiv - Plant Biology 2024Quote: ... Illumina single end sequencing was subsequently performed (1×100) on a NextSeq 2000 System (Illumina).
-
bioRxiv - Genomics 2024Quote: ... and single-end 1 x 150-bp reads were sequenced on a NextSeq 2000 (Illumina) device ...